ID: 939642081

View in Genome Browser
Species Human (GRCh38)
Location 2:144652829-144652851
Sequence CAGAGATATCAGATTTAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939642081_939642083 10 Left 939642081 2:144652829-144652851 CCTAATTAAATCTGATATCTCTG No data
Right 939642083 2:144652862-144652884 AATGATTTGTAATAGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939642081 Original CRISPR CAGAGATATCAGATTTAATT AGG (reversed) Intergenic
No off target data available for this crispr