ID: 939643499

View in Genome Browser
Species Human (GRCh38)
Location 2:144668795-144668817
Sequence GTTCTAAGAAGAATAAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939643497_939643499 3 Left 939643497 2:144668769-144668791 CCTAAGAATATAAAACATGAGAG No data
Right 939643499 2:144668795-144668817 GTTCTAAGAAGAATAAATTGTGG No data
939643495_939643499 13 Left 939643495 2:144668759-144668781 CCTTTCACCTCCTAAGAATATAA No data
Right 939643499 2:144668795-144668817 GTTCTAAGAAGAATAAATTGTGG No data
939643496_939643499 6 Left 939643496 2:144668766-144668788 CCTCCTAAGAATATAAAACATGA No data
Right 939643499 2:144668795-144668817 GTTCTAAGAAGAATAAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939643499 Original CRISPR GTTCTAAGAAGAATAAATTG TGG Intergenic
No off target data available for this crispr