ID: 939647245

View in Genome Browser
Species Human (GRCh38)
Location 2:144715810-144715832
Sequence ATGTTCCAGGAGAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939647245_939647248 -3 Left 939647245 2:144715810-144715832 CCCTCACTCTTCTCCTGGAACAT No data
Right 939647248 2:144715830-144715852 CATTGTTATAGCTTCCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939647245 Original CRISPR ATGTTCCAGGAGAAGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr