ID: 939651286

View in Genome Browser
Species Human (GRCh38)
Location 2:144765669-144765691
Sequence CTTTATAGACAGATAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939651286_939651287 -4 Left 939651286 2:144765669-144765691 CCAAGCTCTATCTGTCTATAAAG No data
Right 939651287 2:144765688-144765710 AAAGACCTTGCTATATTTCTAGG No data
939651286_939651288 -1 Left 939651286 2:144765669-144765691 CCAAGCTCTATCTGTCTATAAAG No data
Right 939651288 2:144765691-144765713 GACCTTGCTATATTTCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939651286 Original CRISPR CTTTATAGACAGATAGAGCT TGG (reversed) Intergenic
No off target data available for this crispr