ID: 939651378

View in Genome Browser
Species Human (GRCh38)
Location 2:144766897-144766919
Sequence ACTATCCTCTGCACAGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939651374_939651378 30 Left 939651374 2:144766844-144766866 CCACATGACAGGACAGAGAGGAA No data
Right 939651378 2:144766897-144766919 ACTATCCTCTGCACAGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939651378 Original CRISPR ACTATCCTCTGCACAGGTAG GGG Intergenic
No off target data available for this crispr