ID: 939652007

View in Genome Browser
Species Human (GRCh38)
Location 2:144775099-144775121
Sequence CCCAGGAGCCACATCAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939652007_939652012 12 Left 939652007 2:144775099-144775121 CCACATTTGATGTGGCTCCTGGG No data
Right 939652012 2:144775134-144775156 CTGAATGTTCAACATGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939652007 Original CRISPR CCCAGGAGCCACATCAAATG TGG (reversed) Intergenic
No off target data available for this crispr