ID: 939652012

View in Genome Browser
Species Human (GRCh38)
Location 2:144775134-144775156
Sequence CTGAATGTTCAACATGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939652011_939652012 -5 Left 939652011 2:144775116-144775138 CCTGGGGTCACATGGTGTCTGAA No data
Right 939652012 2:144775134-144775156 CTGAATGTTCAACATGATCCTGG No data
939652007_939652012 12 Left 939652007 2:144775099-144775121 CCACATTTGATGTGGCTCCTGGG No data
Right 939652012 2:144775134-144775156 CTGAATGTTCAACATGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939652012 Original CRISPR CTGAATGTTCAACATGATCC TGG Intergenic
No off target data available for this crispr