ID: 939653787

View in Genome Browser
Species Human (GRCh38)
Location 2:144797012-144797034
Sequence ACACCCATTAATATGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939653787_939653790 0 Left 939653787 2:144797012-144797034 CCTCTTTTCATATTAATGGGTGT No data
Right 939653790 2:144797035-144797057 AAAAGGAACTTCAGCTGGTAAGG No data
939653787_939653789 -5 Left 939653787 2:144797012-144797034 CCTCTTTTCATATTAATGGGTGT No data
Right 939653789 2:144797030-144797052 GGTGTAAAAGGAACTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939653787 Original CRISPR ACACCCATTAATATGAAAAG AGG (reversed) Intergenic
No off target data available for this crispr