ID: 939653789

View in Genome Browser
Species Human (GRCh38)
Location 2:144797030-144797052
Sequence GGTGTAAAAGGAACTTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939653787_939653789 -5 Left 939653787 2:144797012-144797034 CCTCTTTTCATATTAATGGGTGT No data
Right 939653789 2:144797030-144797052 GGTGTAAAAGGAACTTCAGCTGG No data
939653785_939653789 -2 Left 939653785 2:144797009-144797031 CCTCCTCTTTTCATATTAATGGG No data
Right 939653789 2:144797030-144797052 GGTGTAAAAGGAACTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939653789 Original CRISPR GGTGTAAAAGGAACTTCAGC TGG Intergenic
No off target data available for this crispr