ID: 939654141

View in Genome Browser
Species Human (GRCh38)
Location 2:144801841-144801863
Sequence GGGTGGGTATATAAGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939654133_939654141 12 Left 939654133 2:144801806-144801828 CCTGAGGCAAGGACTTGGTGGCA No data
Right 939654141 2:144801841-144801863 GGGTGGGTATATAAGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939654141 Original CRISPR GGGTGGGTATATAAGGAAGT AGG Intergenic
No off target data available for this crispr