ID: 939656846

View in Genome Browser
Species Human (GRCh38)
Location 2:144836730-144836752
Sequence ACTCGGAAGAGTCTTGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939656846_939656855 9 Left 939656846 2:144836730-144836752 CCCTTCTCAAGACTCTTCCGAGT No data
Right 939656855 2:144836762-144836784 ACTCTGGCTTCCACGGGTAATGG No data
939656846_939656853 2 Left 939656846 2:144836730-144836752 CCCTTCTCAAGACTCTTCCGAGT No data
Right 939656853 2:144836755-144836777 CTGGGGAACTCTGGCTTCCACGG No data
939656846_939656854 3 Left 939656846 2:144836730-144836752 CCCTTCTCAAGACTCTTCCGAGT No data
Right 939656854 2:144836756-144836778 TGGGGAACTCTGGCTTCCACGGG No data
939656846_939656851 -7 Left 939656846 2:144836730-144836752 CCCTTCTCAAGACTCTTCCGAGT No data
Right 939656851 2:144836746-144836768 TCCGAGTCACTGGGGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939656846 Original CRISPR ACTCGGAAGAGTCTTGAGAA GGG (reversed) Intergenic
No off target data available for this crispr