ID: 939656847

View in Genome Browser
Species Human (GRCh38)
Location 2:144836731-144836753
Sequence GACTCGGAAGAGTCTTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939656847_939656853 1 Left 939656847 2:144836731-144836753 CCTTCTCAAGACTCTTCCGAGTC No data
Right 939656853 2:144836755-144836777 CTGGGGAACTCTGGCTTCCACGG No data
939656847_939656854 2 Left 939656847 2:144836731-144836753 CCTTCTCAAGACTCTTCCGAGTC No data
Right 939656854 2:144836756-144836778 TGGGGAACTCTGGCTTCCACGGG No data
939656847_939656851 -8 Left 939656847 2:144836731-144836753 CCTTCTCAAGACTCTTCCGAGTC No data
Right 939656851 2:144836746-144836768 TCCGAGTCACTGGGGAACTCTGG No data
939656847_939656855 8 Left 939656847 2:144836731-144836753 CCTTCTCAAGACTCTTCCGAGTC No data
Right 939656855 2:144836762-144836784 ACTCTGGCTTCCACGGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939656847 Original CRISPR GACTCGGAAGAGTCTTGAGA AGG (reversed) Intergenic