ID: 939656851

View in Genome Browser
Species Human (GRCh38)
Location 2:144836746-144836768
Sequence TCCGAGTCACTGGGGAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939656846_939656851 -7 Left 939656846 2:144836730-144836752 CCCTTCTCAAGACTCTTCCGAGT No data
Right 939656851 2:144836746-144836768 TCCGAGTCACTGGGGAACTCTGG No data
939656847_939656851 -8 Left 939656847 2:144836731-144836753 CCTTCTCAAGACTCTTCCGAGTC No data
Right 939656851 2:144836746-144836768 TCCGAGTCACTGGGGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939656851 Original CRISPR TCCGAGTCACTGGGGAACTC TGG Intergenic
No off target data available for this crispr