ID: 939656852

View in Genome Browser
Species Human (GRCh38)
Location 2:144836747-144836769
Sequence GCCAGAGTTCCCCAGTGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939656852_939656855 -8 Left 939656852 2:144836747-144836769 CCGAGTCACTGGGGAACTCTGGC No data
Right 939656855 2:144836762-144836784 ACTCTGGCTTCCACGGGTAATGG No data
939656852_939656858 22 Left 939656852 2:144836747-144836769 CCGAGTCACTGGGGAACTCTGGC No data
Right 939656858 2:144836792-144836814 TCCACTCACTTAGAGAAGGAAGG No data
939656852_939656857 18 Left 939656852 2:144836747-144836769 CCGAGTCACTGGGGAACTCTGGC No data
Right 939656857 2:144836788-144836810 TCGCTCCACTCACTTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939656852 Original CRISPR GCCAGAGTTCCCCAGTGACT CGG (reversed) Intergenic
No off target data available for this crispr