ID: 939656853

View in Genome Browser
Species Human (GRCh38)
Location 2:144836755-144836777
Sequence CTGGGGAACTCTGGCTTCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939656846_939656853 2 Left 939656846 2:144836730-144836752 CCCTTCTCAAGACTCTTCCGAGT No data
Right 939656853 2:144836755-144836777 CTGGGGAACTCTGGCTTCCACGG No data
939656847_939656853 1 Left 939656847 2:144836731-144836753 CCTTCTCAAGACTCTTCCGAGTC No data
Right 939656853 2:144836755-144836777 CTGGGGAACTCTGGCTTCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939656853 Original CRISPR CTGGGGAACTCTGGCTTCCA CGG Intergenic
No off target data available for this crispr