ID: 939656855

View in Genome Browser
Species Human (GRCh38)
Location 2:144836762-144836784
Sequence ACTCTGGCTTCCACGGGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939656846_939656855 9 Left 939656846 2:144836730-144836752 CCCTTCTCAAGACTCTTCCGAGT No data
Right 939656855 2:144836762-144836784 ACTCTGGCTTCCACGGGTAATGG No data
939656847_939656855 8 Left 939656847 2:144836731-144836753 CCTTCTCAAGACTCTTCCGAGTC No data
Right 939656855 2:144836762-144836784 ACTCTGGCTTCCACGGGTAATGG No data
939656852_939656855 -8 Left 939656852 2:144836747-144836769 CCGAGTCACTGGGGAACTCTGGC No data
Right 939656855 2:144836762-144836784 ACTCTGGCTTCCACGGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939656855 Original CRISPR ACTCTGGCTTCCACGGGTAA TGG Intergenic
No off target data available for this crispr