ID: 939666962

View in Genome Browser
Species Human (GRCh38)
Location 2:144964401-144964423
Sequence CTAGTCCTGCCCTTGACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939666962_939666965 1 Left 939666962 2:144964401-144964423 CCATGTGTCAAGGGCAGGACTAG No data
Right 939666965 2:144964425-144964447 TGGAGATAACTGAATCATTGTGG No data
939666962_939666966 4 Left 939666962 2:144964401-144964423 CCATGTGTCAAGGGCAGGACTAG No data
Right 939666966 2:144964428-144964450 AGATAACTGAATCATTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939666962 Original CRISPR CTAGTCCTGCCCTTGACACA TGG (reversed) Intergenic
No off target data available for this crispr