ID: 939672846

View in Genome Browser
Species Human (GRCh38)
Location 2:145034848-145034870
Sequence CCATTGGTATGGAGTTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 118}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939672846_939672856 16 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672856 2:145034887-145034909 TAAGTAGAAATGACAATAGGAGG No data
939672846_939672861 23 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672861 2:145034894-145034916 AAATGACAATAGGAGGGGGAGGG No data
939672846_939672859 19 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672859 2:145034890-145034912 GTAGAAATGACAATAGGAGGGGG No data
939672846_939672857 17 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672857 2:145034888-145034910 AAGTAGAAATGACAATAGGAGGG No data
939672846_939672862 29 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672862 2:145034900-145034922 CAATAGGAGGGGGAGGGTAGAGG No data
939672846_939672858 18 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672858 2:145034889-145034911 AGTAGAAATGACAATAGGAGGGG No data
939672846_939672860 22 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672860 2:145034893-145034915 GAAATGACAATAGGAGGGGGAGG No data
939672846_939672851 -7 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672851 2:145034864-145034886 CCAATGGAGCATTCCCCAAAAGG 0: 1
1: 0
2: 0
3: 10
4: 97
939672846_939672855 13 Left 939672846 2:145034848-145034870 CCACCAAAACTCCATACCAATGG 0: 1
1: 0
2: 2
3: 13
4: 118
Right 939672855 2:145034884-145034906 AGGTAAGTAGAAATGACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939672846 Original CRISPR CCATTGGTATGGAGTTTTGG TGG (reversed) Intergenic
900727952 1:4230715-4230737 CTTTTGGCATGCAGTTTTGGGGG - Intergenic
901852436 1:12024245-12024267 GCATTGGTATGAAGTTGTGCAGG - Intronic
902077409 1:13798798-13798820 CCATTGCTATGTATTTTGGGAGG - Intronic
904289477 1:29474979-29475001 CCAGTGGTATGGAGGTCTGAAGG + Intergenic
905752909 1:40481476-40481498 CCATTGGTAGAGTTTTTTGGAGG + Intronic
913243096 1:116847551-116847573 CCATGGCCATGGAGGTTTGGAGG - Intergenic
914226551 1:145724029-145724051 ACATTGTTACGGAGCTTTGGGGG - Intronic
918207340 1:182321067-182321089 CCATTGAAGTGGAGGTTTGGAGG + Intergenic
919810330 1:201405258-201405280 CCAGTGCTATGGGGTTTTCGAGG + Exonic
923600578 1:235399283-235399305 CCATTAGTTTGGAGTTGTGGTGG + Intronic
923918288 1:238534247-238534269 CCATTGATATGGAATTCTAGAGG - Intergenic
924112305 1:240712126-240712148 CCACTAGTATGGGTTTTTGGAGG - Intergenic
1063301387 10:4852088-4852110 CCATTGGAATAGAGTTTTGCAGG - Intergenic
1064431925 10:15278774-15278796 TAATAGGTATGGGGTTTTGGGGG + Intronic
1071328343 10:84538189-84538211 CCCTTGGTTTGGACTTTGGGTGG + Intergenic
1073604111 10:104876639-104876661 ACAATGGTGTGGAGTTTTGGGGG - Intronic
1079823481 11:25160772-25160794 CCCTTGGTAGGGAGGTTTGCAGG + Intergenic
1080644148 11:34175920-34175942 GCATTGGAATGGAGTCTTGAAGG - Intronic
1082128266 11:48456948-48456970 CCATGGGGTTGGAGGTTTGGGGG - Intergenic
1082561816 11:54627873-54627895 CCATGGGGTTGGAGGTTTGGGGG - Intergenic
1083387915 11:62325720-62325742 CCTTTGACCTGGAGTTTTGGGGG + Intergenic
1085401785 11:76239916-76239938 CCACTGGGATGGAGTTTGAGTGG - Intergenic
1086041445 11:82484113-82484135 TAATGGGTATGAAGTTTTGGGGG + Intergenic
1087875410 11:103350015-103350037 ATGTTGGTATGTAGTTTTGGGGG + Intronic
1089041649 11:115456791-115456813 ACATTGATATGGTGTTTTTGAGG - Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1091689241 12:2584451-2584473 CCCTTGGTTTGGGGTTTTGGTGG - Intronic
1093040487 12:14373764-14373786 CCATTGAAATGGTATTTTGGGGG + Intronic
1097147127 12:56949411-56949433 CCCTTGGTATCGAGGTTTGTGGG + Intergenic
1097455212 12:59792065-59792087 ACCTTTGAATGGAGTTTTGGTGG + Intergenic
1098111814 12:67130230-67130252 CCATTTATATGGAGATTTAGGGG + Intergenic
1098749158 12:74273311-74273333 CTAAGGGTATGGAGTTTGGGGGG - Intergenic
1100534323 12:95492409-95492431 CCACTTATAAGGAGTTTTGGGGG + Intronic
1101257796 12:102997000-102997022 CTCTTGGTATGGAATTTTGGGGG + Intergenic
1102634453 12:114310810-114310832 CCAATTGTTTGCAGTTTTGGTGG + Intergenic
1102906240 12:116677492-116677514 CTATTGGTATGGGGTTTTTGGGG - Intergenic
1108206901 13:48099478-48099500 CAGTTGGTGTGGAGGTTTGGAGG + Intergenic
1111181016 13:84665130-84665152 GAATTGGACTGGAGTTTTGGAGG + Intergenic
1113297392 13:108974460-108974482 CCAATTTTATGGATTTTTGGGGG - Intronic
1116653988 14:47628043-47628065 CCATAGTTTTGGGGTTTTGGTGG + Intronic
1120344813 14:83272921-83272943 CCATAGGTAAGGACTTTTAGAGG - Intergenic
1121213225 14:92225375-92225397 AAATTGGTTTGGAGTTTGGGTGG - Intergenic
1122764347 14:104055133-104055155 CCATTTATAGGGAGTTGTGGGGG - Intergenic
1128351416 15:66892836-66892858 CCGATGGTTTTGAGTTTTGGAGG - Intergenic
1128366634 15:67008264-67008286 CCAGGGGTATGCAGATTTGGGGG - Intergenic
1129379844 15:75158060-75158082 CCAGTGATAAGGTGTTTTGGGGG + Intergenic
1130030286 15:80307916-80307938 ACATTTGGATGGGGTTTTGGTGG + Intergenic
1131987412 15:98058594-98058616 ACATTTGTCTGTAGTTTTGGGGG + Intergenic
1133660956 16:7917063-7917085 CCATTGGCATTGAGCTTTGGTGG - Intergenic
1135693531 16:24565758-24565780 CTCTTGTTATGAAGTTTTGGAGG - Intronic
1141762655 16:86038911-86038933 CCGTCCGTGTGGAGTTTTGGAGG + Intergenic
1142782537 17:2192281-2192303 CCAGTGGGATGGAGTTTGGTTGG + Intronic
1142835520 17:2583119-2583141 ACATTGGTAAGTATTTTTGGAGG + Intergenic
1143612945 17:8030541-8030563 CCATTTGAATGGGGTTTTGGAGG - Intergenic
1144338736 17:14296137-14296159 CAACTGGTGTGGAGGTTTGGTGG + Intergenic
1147129421 17:38398052-38398074 CCATTTGTCTTGAGTGTTGGGGG + Intronic
1148236927 17:45975200-45975222 CCATTGGTTTGGTGATTTGGAGG + Intronic
1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG + Intronic
1149620015 17:58037278-58037300 CAATGGGTATAGAGTTTTTGGGG + Intergenic
1157402483 18:47400104-47400126 TAATTGGCATGGACTTTTGGTGG - Intergenic
1158029707 18:52948638-52948660 CCATAGGGATTCAGTTTTGGAGG - Intronic
1159209069 18:65292346-65292368 TCCTTGGTAGGGAGTTGTGGTGG - Intergenic
1162953395 19:14085244-14085266 CCATGGGTAAGGAGACTTGGAGG - Intronic
1163066346 19:14799136-14799158 CCATTGGGAGGCACTTTTGGTGG - Exonic
1164973966 19:32557395-32557417 CCATTTGCTTTGAGTTTTGGTGG - Intergenic
926877660 2:17501034-17501056 TCATTATTATGGAGATTTGGGGG - Intergenic
928381162 2:30820004-30820026 CCATTGATAGCCAGTTTTGGGGG + Intronic
931054151 2:58449954-58449976 CCATTGGTGTGGGGGTTTGAAGG - Intergenic
933603010 2:84352792-84352814 CCTTTGACATGGACTTTTGGAGG + Intergenic
933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG + Intergenic
937237886 2:120441800-120441822 TCTTTGGTATGGGGTGTTGGAGG - Intergenic
938216927 2:129525992-129526014 CCAGTGGACTGGAGGTTTGGAGG + Intergenic
939132679 2:138256503-138256525 CAATGGCTATGGAGTTGTGGAGG + Intergenic
939182902 2:138824658-138824680 CTATTGTTTTGGAGTTTTGGGGG - Intergenic
939373965 2:141339929-141339951 CCAGTGGTGGGGAGGTTTGGAGG - Intronic
939672846 2:145034848-145034870 CCATTGGTATGGAGTTTTGGTGG - Intergenic
942091969 2:172500736-172500758 CCATCAGTATAGAGTTTTGTTGG - Intronic
942120766 2:172774408-172774430 CCAATGGTTTGGAGTTCTAGTGG - Intronic
943901088 2:193437585-193437607 ACAATGGTATCGAGTTCTGGAGG + Intergenic
945790620 2:214300362-214300384 CCATTGGTTTAGTGTTTTGCTGG + Intronic
1173054286 20:39596322-39596344 CCATTTTTATAGAGTTTTGTAGG - Intergenic
1174265423 20:49328377-49328399 CACTTGGTGTGGTGTTTTGGGGG + Intergenic
1182491399 22:30674560-30674582 CCAGTGGTAAGGAGGTGTGGGGG + Intergenic
1184509903 22:44927282-44927304 CCGTTGGTTTGGAGTTTTGGGGG - Intronic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
950503480 3:13378591-13378613 CCATTGCTATGGACATTTAGAGG - Intronic
953505531 3:43482540-43482562 ACCTGGGTATGGTGTTTTGGGGG - Intronic
957930835 3:86876326-86876348 ACCTTAGTATGGAGTTTTTGTGG + Intergenic
961312386 3:126011610-126011632 GTATTGGTATGGACTTTTTGGGG - Intronic
963102284 3:141619089-141619111 CCATTGTCATGGAGTTTTTGGGG - Intergenic
963957784 3:151274474-151274496 ACATAGGTAGGCAGTTTTGGGGG + Intronic
965585809 3:170317270-170317292 CTAATGGTTTTGAGTTTTGGGGG - Intergenic
967106220 3:186256825-186256847 ACATTGGCATGGAGATCTGGAGG - Intronic
968131651 3:196195879-196195901 CCATTGGGCTGGAGATCTGGAGG + Intergenic
968667881 4:1831134-1831156 CCATGGGTGTGGAGGTTTTGTGG + Intronic
973311018 4:48709656-48709678 TGATTGGTAAGGATTTTTGGTGG - Intronic
974352072 4:60761265-60761287 GCATTGGCTTGCAGTTTTGGAGG - Intergenic
976661350 4:87543636-87543658 CCATAGATTTGGAATTTTGGGGG - Intergenic
983360950 4:166722495-166722517 CTATTGTTATGTAGGTTTGGTGG + Intergenic
983670211 4:170228371-170228393 ACATTTGTATGCAATTTTGGTGG + Intergenic
984854095 4:184177849-184177871 ACATTTGGATGGAGTTTTTGTGG - Intronic
986129750 5:4918021-4918043 CCATTTGTATGGAATCTTTGAGG - Intergenic
987925565 5:24336531-24336553 CCATTAGGGTGGAGTTTGGGCGG + Intergenic
994152234 5:96460986-96461008 TAATGGGTATGGGGTTTTGGGGG - Intergenic
994942518 5:106343084-106343106 CCATTGCTATGGAGTGATGAAGG - Intergenic
998714567 5:144868202-144868224 CAATTGGTATGGAGATTTAAAGG + Intergenic
998876090 5:146600919-146600941 CAATGGATATGGAGTTTTTGGGG - Intronic
999565362 5:152854234-152854256 CTATTGTTATGTAGTTGTGGGGG - Intergenic
1001421175 5:171588503-171588525 CCCTTTGCATGGAGTCTTGGTGG - Intergenic
1004464431 6:15871272-15871294 CCATTTGTATGGAGCTCTAGGGG + Intergenic
1004990533 6:21132795-21132817 CTAGTTGTGTGGAGTTTTGGGGG - Intronic
1005043418 6:21620007-21620029 CTATTGTTATGGGATTTTGGGGG + Intergenic
1020943759 7:14574646-14574668 CTATTGGTATAAAGTTTTGTGGG - Intronic
1022705358 7:32797005-32797027 AGAGTGGTATGGGGTTTTGGGGG - Intergenic
1022988252 7:35681863-35681885 CAATAGGTATGGAGTTTCTGGGG + Intronic
1023124659 7:36943510-36943532 CAATTTGATTGGAGTTTTGGGGG + Intronic
1030295661 7:107923627-107923649 TCAAGGGTGTGGAGTTTTGGAGG + Intronic
1033706854 7:143897496-143897518 CTATTAGTATTGAGTTTTGTAGG + Intronic
1039083865 8:33760408-33760430 CTATAGGTCTGGAGTCTTGGCGG + Intergenic
1039709883 8:40045031-40045053 ATATTGGTCTGTAGTTTTGGGGG + Intergenic
1040356571 8:46624319-46624341 CCATTGGAATGGAAGGTTGGAGG - Intergenic
1042354309 8:67809480-67809502 CCATGGATGTGAAGTTTTGGTGG + Intergenic
1044786715 8:95801796-95801818 CCTTTGGCATGATGTTTTGGAGG - Intergenic
1046019749 8:108650466-108650488 CCAATGGTATGGAGTTTTATAGG - Intronic
1051231146 9:14956986-14957008 GCATTAGTATGGGGTTTTGCTGG + Intergenic
1051247777 9:15128913-15128935 AGAATGGTATGGAGATTTGGAGG - Intergenic
1053728326 9:41026673-41026695 CCATTGGGGTGCAGTTCTGGAGG - Intergenic
1054700179 9:68405407-68405429 CCATTGGGGTGCAGTTCTGGAGG + Intronic
1055490015 9:76795301-76795323 CCATAGTTATGGTGTTTTGACGG - Intronic
1061724686 9:132575649-132575671 TCATTGGGAAGGGGTTTTGGGGG - Intergenic
1190518113 X:51246087-51246109 CCTTTGGTATGGAGTAATGTTGG - Intergenic
1192781371 X:74296709-74296731 CCATTGGTAAATAGTGTTGGTGG - Intergenic
1195671596 X:107474582-107474604 TCATTGGTAGGGGGTTTAGGAGG + Intergenic
1198751846 X:139944080-139944102 CCACTGGTATGGATTTAGGGAGG + Intronic