ID: 939674127

View in Genome Browser
Species Human (GRCh38)
Location 2:145050663-145050685
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939674125_939674127 -10 Left 939674125 2:145050650-145050672 CCACCTGTGTTGAGCCTGAAGAC No data
Right 939674127 2:145050663-145050685 GCCTGAAGACCTTTAGTGTCTGG No data
939674124_939674127 23 Left 939674124 2:145050617-145050639 CCAGGCAAAAGGACTTTGCGAAC No data
Right 939674127 2:145050663-145050685 GCCTGAAGACCTTTAGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type