ID: 939674582

View in Genome Browser
Species Human (GRCh38)
Location 2:145056168-145056190
Sequence CACAAAAATTAGCTGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4755
Summary {0: 4, 1: 58, 2: 675, 3: 1374, 4: 2644}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939674578_939674582 -7 Left 939674578 2:145056152-145056174 CCGTCTTTACAAAAAACACAAAA No data
Right 939674582 2:145056168-145056190 CACAAAAATTAGCTGGGCTTGGG 0: 4
1: 58
2: 675
3: 1374
4: 2644
939674576_939674582 18 Left 939674576 2:145056127-145056149 CCAACCTGGGCAACATGGCAAAA 0: 305
1: 7257
2: 30771
3: 73498
4: 226583
Right 939674582 2:145056168-145056190 CACAAAAATTAGCTGGGCTTGGG 0: 4
1: 58
2: 675
3: 1374
4: 2644
939674577_939674582 14 Left 939674577 2:145056131-145056153 CCTGGGCAACATGGCAAAACTCC 0: 311
1: 4738
2: 23032
3: 70855
4: 198074
Right 939674582 2:145056168-145056190 CACAAAAATTAGCTGGGCTTGGG 0: 4
1: 58
2: 675
3: 1374
4: 2644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939674582 Original CRISPR CACAAAAATTAGCTGGGCTT GGG Intergenic
Too many off-targets to display for this crispr