ID: 939677905

View in Genome Browser
Species Human (GRCh38)
Location 2:145095317-145095339
Sequence GGGTCAAGAATATCTCCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939677905_939677911 12 Left 939677905 2:145095317-145095339 CCAGTGGGAGATATTCTTGACCC No data
Right 939677911 2:145095352-145095374 ATCATTCATGAGGTAGTCTAGGG No data
939677905_939677910 11 Left 939677905 2:145095317-145095339 CCAGTGGGAGATATTCTTGACCC No data
Right 939677910 2:145095351-145095373 TATCATTCATGAGGTAGTCTAGG No data
939677905_939677908 2 Left 939677905 2:145095317-145095339 CCAGTGGGAGATATTCTTGACCC No data
Right 939677908 2:145095342-145095364 AGATGCCAATATCATTCATGAGG No data
939677905_939677914 26 Left 939677905 2:145095317-145095339 CCAGTGGGAGATATTCTTGACCC No data
Right 939677914 2:145095366-145095388 AGTCTAGGGATTCTAGAGGTGGG No data
939677905_939677915 27 Left 939677905 2:145095317-145095339 CCAGTGGGAGATATTCTTGACCC No data
Right 939677915 2:145095367-145095389 GTCTAGGGATTCTAGAGGTGGGG No data
939677905_939677912 22 Left 939677905 2:145095317-145095339 CCAGTGGGAGATATTCTTGACCC No data
Right 939677912 2:145095362-145095384 AGGTAGTCTAGGGATTCTAGAGG No data
939677905_939677913 25 Left 939677905 2:145095317-145095339 CCAGTGGGAGATATTCTTGACCC No data
Right 939677913 2:145095365-145095387 TAGTCTAGGGATTCTAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939677905 Original CRISPR GGGTCAAGAATATCTCCCAC TGG (reversed) Intergenic
No off target data available for this crispr