ID: 939678743

View in Genome Browser
Species Human (GRCh38)
Location 2:145104625-145104647
Sequence CTGCTGTTTTAGAGGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939678736_939678743 18 Left 939678736 2:145104584-145104606 CCTTTTTAAAGAAATTATCAGTA No data
Right 939678743 2:145104625-145104647 CTGCTGTTTTAGAGGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939678743 Original CRISPR CTGCTGTTTTAGAGGGGACA AGG Intergenic
No off target data available for this crispr