ID: 939679848

View in Genome Browser
Species Human (GRCh38)
Location 2:145116947-145116969
Sequence AAGTATGCATAGATTTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939679848_939679854 19 Left 939679848 2:145116947-145116969 CCCCTCCAAATCTATGCATACTT No data
Right 939679854 2:145116989-145117011 CTCAAACAAGAACAATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939679848 Original CRISPR AAGTATGCATAGATTTGGAG GGG (reversed) Intergenic
No off target data available for this crispr