ID: 939697184

View in Genome Browser
Species Human (GRCh38)
Location 2:145341179-145341201
Sequence GGGTTTACAAGCTAATGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939697178_939697184 17 Left 939697178 2:145341139-145341161 CCAGTAGTGAAAAACTAAAAGTG No data
Right 939697184 2:145341179-145341201 GGGTTTACAAGCTAATGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939697184 Original CRISPR GGGTTTACAAGCTAATGGAG AGG Intergenic
No off target data available for this crispr