ID: 939698631

View in Genome Browser
Species Human (GRCh38)
Location 2:145360651-145360673
Sequence GCTCATTTAAGTTCCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939698627_939698631 13 Left 939698627 2:145360615-145360637 CCTCATTCCCTCTTTGTCTTATA No data
Right 939698631 2:145360651-145360673 GCTCATTTAAGTTCCCAGACTGG No data
939698629_939698631 6 Left 939698629 2:145360622-145360644 CCCTCTTTGTCTTATAAGGTGCT No data
Right 939698631 2:145360651-145360673 GCTCATTTAAGTTCCCAGACTGG No data
939698630_939698631 5 Left 939698630 2:145360623-145360645 CCTCTTTGTCTTATAAGGTGCTG No data
Right 939698631 2:145360651-145360673 GCTCATTTAAGTTCCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939698631 Original CRISPR GCTCATTTAAGTTCCCAGAC TGG Intergenic
No off target data available for this crispr