ID: 939722207

View in Genome Browser
Species Human (GRCh38)
Location 2:145667878-145667900
Sequence CTGGAGGACCTGGGAAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939722207_939722214 5 Left 939722207 2:145667878-145667900 CCCGTTTTTCCCAGGTCCTCCAG No data
Right 939722214 2:145667906-145667928 TTCACCCTACAGGCAATTTCTGG No data
939722207_939722212 -5 Left 939722207 2:145667878-145667900 CCCGTTTTTCCCAGGTCCTCCAG No data
Right 939722212 2:145667896-145667918 TCCAGTTTTCTTCACCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939722207 Original CRISPR CTGGAGGACCTGGGAAAAAC GGG (reversed) Intergenic
No off target data available for this crispr