ID: 939722207 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:145667878-145667900 |
| Sequence | CTGGAGGACCTGGGAAAAAC GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939722207_939722214 | 5 | Left | 939722207 | 2:145667878-145667900 | CCCGTTTTTCCCAGGTCCTCCAG | No data | ||
| Right | 939722214 | 2:145667906-145667928 | TTCACCCTACAGGCAATTTCTGG | No data | ||||
| 939722207_939722212 | -5 | Left | 939722207 | 2:145667878-145667900 | CCCGTTTTTCCCAGGTCCTCCAG | No data | ||
| Right | 939722212 | 2:145667896-145667918 | TCCAGTTTTCTTCACCCTACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939722207 | Original CRISPR | CTGGAGGACCTGGGAAAAAC GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||