ID: 939723243

View in Genome Browser
Species Human (GRCh38)
Location 2:145681221-145681243
Sequence ACATATATACAAAAGTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939723238_939723243 17 Left 939723238 2:145681181-145681203 CCTGACCAACATGGAGAAACCCT 0: 4789
1: 23146
2: 70192
3: 159116
4: 185415
Right 939723243 2:145681221-145681243 ACATATATACAAAAGTAGCCAGG No data
939723242_939723243 -10 Left 939723242 2:145681208-145681230 CCATTTAAAAAATACATATATAC No data
Right 939723243 2:145681221-145681243 ACATATATACAAAAGTAGCCAGG No data
939723241_939723243 -3 Left 939723241 2:145681201-145681223 CCTGTCTCCATTTAAAAAATACA No data
Right 939723243 2:145681221-145681243 ACATATATACAAAAGTAGCCAGG No data
939723240_939723243 -2 Left 939723240 2:145681200-145681222 CCCTGTCTCCATTTAAAAAATAC No data
Right 939723243 2:145681221-145681243 ACATATATACAAAAGTAGCCAGG No data
939723237_939723243 21 Left 939723237 2:145681177-145681199 CCAGCCTGACCAACATGGAGAAA 0: 18586
1: 36319
2: 134688
3: 174060
4: 144372
Right 939723243 2:145681221-145681243 ACATATATACAAAAGTAGCCAGG No data
939723239_939723243 12 Left 939723239 2:145681186-145681208 CCAACATGGAGAAACCCTGTCTC 0: 5273
1: 47619
2: 102758
3: 135889
4: 105464
Right 939723243 2:145681221-145681243 ACATATATACAAAAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939723243 Original CRISPR ACATATATACAAAAGTAGCC AGG Intergenic
No off target data available for this crispr