ID: 939724397

View in Genome Browser
Species Human (GRCh38)
Location 2:145698235-145698257
Sequence CATGTTAAGGAGAAATTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939724392_939724397 -10 Left 939724392 2:145698222-145698244 CCAGATTTCCAGACATGTTAAGG No data
Right 939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939724397 Original CRISPR CATGTTAAGGAGAAATTGGA GGG Intergenic
No off target data available for this crispr