ID: 939725277

View in Genome Browser
Species Human (GRCh38)
Location 2:145712065-145712087
Sequence CTGTGTTCTCACTTCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939725265_939725277 29 Left 939725265 2:145712013-145712035 CCCTCTTCCCTGCTCCTAGCCAT No data
Right 939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG No data
939725276_939725277 5 Left 939725276 2:145712037-145712059 CCACATTTCTGGGGAAGTTGGGT No data
Right 939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG No data
939725270_939725277 15 Left 939725270 2:145712027-145712049 CCTAGCCATACCACATTTCTGGG No data
Right 939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG No data
939725266_939725277 28 Left 939725266 2:145712014-145712036 CCTCTTCCCTGCTCCTAGCCATA No data
Right 939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG No data
939725268_939725277 21 Left 939725268 2:145712021-145712043 CCTGCTCCTAGCCATACCACATT No data
Right 939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG No data
939725273_939725277 10 Left 939725273 2:145712032-145712054 CCATACCACATTTCTGGGGAAGT No data
Right 939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG No data
939725267_939725277 22 Left 939725267 2:145712020-145712042 CCCTGCTCCTAGCCATACCACAT No data
Right 939725277 2:145712065-145712087 CTGTGTTCTCACTTCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939725277 Original CRISPR CTGTGTTCTCACTTCTCCCA TGG Intergenic
No off target data available for this crispr