ID: 939728215

View in Genome Browser
Species Human (GRCh38)
Location 2:145750232-145750254
Sequence CAGTATGACTGGAAAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939728215_939728217 -1 Left 939728215 2:145750232-145750254 CCAGCTTCTTTCCAGTCATACTG No data
Right 939728217 2:145750254-145750276 GCGTACACATCCACCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939728215 Original CRISPR CAGTATGACTGGAAAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr