ID: 939730405

View in Genome Browser
Species Human (GRCh38)
Location 2:145777571-145777593
Sequence CTCATCATGCTGGACATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939730405_939730412 30 Left 939730405 2:145777571-145777593 CCCTCCATGTCCAGCATGATGAG No data
Right 939730412 2:145777624-145777646 TCAAGTAAATATTCAGAGGAAGG No data
939730405_939730409 1 Left 939730405 2:145777571-145777593 CCCTCCATGTCCAGCATGATGAG No data
Right 939730409 2:145777595-145777617 CATTGTAAACAGTATTTCCTAGG No data
939730405_939730411 26 Left 939730405 2:145777571-145777593 CCCTCCATGTCCAGCATGATGAG No data
Right 939730411 2:145777620-145777642 ACATTCAAGTAAATATTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939730405 Original CRISPR CTCATCATGCTGGACATGGA GGG (reversed) Intergenic
No off target data available for this crispr