ID: 939733263

View in Genome Browser
Species Human (GRCh38)
Location 2:145811593-145811615
Sequence GGATGGAGACATTTGCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939733263_939733265 -6 Left 939733263 2:145811593-145811615 CCTAACTGCAAATGTCTCCATCC No data
Right 939733265 2:145811610-145811632 CCATCCAGCTAGTGAACCCCAGG No data
939733263_939733271 12 Left 939733263 2:145811593-145811615 CCTAACTGCAAATGTCTCCATCC No data
Right 939733271 2:145811628-145811650 CCAGGAAGTATGAGGATATGAGG No data
939733263_939733267 4 Left 939733263 2:145811593-145811615 CCTAACTGCAAATGTCTCCATCC No data
Right 939733267 2:145811620-145811642 AGTGAACCCCAGGAAGTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939733263 Original CRISPR GGATGGAGACATTTGCAGTT AGG (reversed) Intergenic
No off target data available for this crispr