ID: 939735356

View in Genome Browser
Species Human (GRCh38)
Location 2:145837397-145837419
Sequence ATATCTACTTAATTTAGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939735356_939735358 -6 Left 939735356 2:145837397-145837419 CCTTAGCTAAATTAAGTAGATAT No data
Right 939735358 2:145837414-145837436 AGATATTTTAATGGAGATGTTGG No data
939735356_939735359 -1 Left 939735356 2:145837397-145837419 CCTTAGCTAAATTAAGTAGATAT No data
Right 939735359 2:145837419-145837441 TTTTAATGGAGATGTTGGTGAGG No data
939735356_939735360 12 Left 939735356 2:145837397-145837419 CCTTAGCTAAATTAAGTAGATAT No data
Right 939735360 2:145837432-145837454 GTTGGTGAGGAATTACTTACTGG No data
939735356_939735361 21 Left 939735356 2:145837397-145837419 CCTTAGCTAAATTAAGTAGATAT No data
Right 939735361 2:145837441-145837463 GAATTACTTACTGGCATAAATGG No data
939735356_939735362 22 Left 939735356 2:145837397-145837419 CCTTAGCTAAATTAAGTAGATAT No data
Right 939735362 2:145837442-145837464 AATTACTTACTGGCATAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939735356 Original CRISPR ATATCTACTTAATTTAGCTA AGG (reversed) Intergenic
No off target data available for this crispr