ID: 939737428

View in Genome Browser
Species Human (GRCh38)
Location 2:145865829-145865851
Sequence CCCACAGTGTGCAAAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939737428_939737431 -6 Left 939737428 2:145865829-145865851 CCTCTCTTTTTGCACACTGTGGG No data
Right 939737431 2:145865846-145865868 TGTGGGAGGACACAAGAAAAAGG No data
939737428_939737432 -3 Left 939737428 2:145865829-145865851 CCTCTCTTTTTGCACACTGTGGG No data
Right 939737432 2:145865849-145865871 GGGAGGACACAAGAAAAAGGTGG No data
939737428_939737433 13 Left 939737428 2:145865829-145865851 CCTCTCTTTTTGCACACTGTGGG No data
Right 939737433 2:145865865-145865887 AAGGTGGCTGTCTGCAAGTCAGG 0: 7
1: 56
2: 192
3: 433
4: 860
939737428_939737434 20 Left 939737428 2:145865829-145865851 CCTCTCTTTTTGCACACTGTGGG No data
Right 939737434 2:145865872-145865894 CTGTCTGCAAGTCAGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939737428 Original CRISPR CCCACAGTGTGCAAAAAGAG AGG (reversed) Intergenic
No off target data available for this crispr