ID: 939743409

View in Genome Browser
Species Human (GRCh38)
Location 2:145938245-145938267
Sequence CGCTGTAACATGGAAATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939743409_939743415 12 Left 939743409 2:145938245-145938267 CCTCCAATTTCCATGTTACAGCG No data
Right 939743415 2:145938280-145938302 AATGAAGGCGCTGAGCACAATGG No data
939743409_939743414 -3 Left 939743409 2:145938245-145938267 CCTCCAATTTCCATGTTACAGCG No data
Right 939743414 2:145938265-145938287 GCGTGGGAGTGATTGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939743409 Original CRISPR CGCTGTAACATGGAAATTGG AGG (reversed) Intergenic
No off target data available for this crispr