ID: 939752755

View in Genome Browser
Species Human (GRCh38)
Location 2:146067838-146067860
Sequence CTGTGGTCCTTGAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939752750_939752755 18 Left 939752750 2:146067797-146067819 CCTAATCTATTTGCAGATATCAG No data
Right 939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939752755 Original CRISPR CTGTGGTCCTTGAGAGAAGG AGG Intergenic
No off target data available for this crispr