ID: 939755058

View in Genome Browser
Species Human (GRCh38)
Location 2:146099999-146100021
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 3, 1: 3, 2: 6, 3: 46, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939755054_939755058 -4 Left 939755054 2:146099980-146100002 CCAAGTGACAGCACTTAATTGCC No data
Right 939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG 0: 3
1: 3
2: 6
3: 46
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900864725 1:5260229-5260251 TGCCACAGAGAAGAGGGGCAGGG - Intergenic
903878999 1:26495956-26495978 TGCAAAATACTAGCTGGGCATGG + Intergenic
906037220 1:42758785-42758807 AGCTAAAGGCAAGGTGGGCAGGG - Intronic
906095803 1:43223166-43223188 TTCCAAGGACGAGGTGGGGAGGG - Intronic
906465262 1:46073224-46073246 TGACAAAGGCAAGGTGGACATGG - Intronic
907656148 1:56343330-56343352 GGTCAAAGAAAAGGTGAGCATGG + Intergenic
908407070 1:63825508-63825530 TGCCTCAGGCAAGGTGGGAATGG + Intronic
910778181 1:90897294-90897316 TGCCAATGACAATGTGGGAGAGG + Intergenic
911657667 1:100463340-100463362 AGCCAAAGACTAGGAGGGGAGGG - Intronic
912393326 1:109320006-109320028 TACCAATGCCAAGGTTGGCAGGG - Intronic
912621548 1:111164777-111164799 TGCAAAAAACTAGCTGGGCATGG - Intronic
912919898 1:113855852-113855874 TGCCTTAGAGAAGCTGGGCAGGG + Intronic
913657089 1:120971626-120971648 TTCCACAGACAAGGTGGGGGTGG + Intergenic
913660369 1:121001684-121001706 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
914008433 1:143754709-143754731 TTCCACAGACAAGGTGGGGGTGG + Intergenic
914011734 1:143784841-143784863 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
914166099 1:145176293-145176315 TGGCAGAGAAAGGGTGGGCATGG + Intergenic
914521652 1:148422880-148422902 TTCCACAGACAAGGTGGGGGTGG + Intergenic
914647063 1:149663361-149663383 TTCCACAGACAAGGTGGGGGTGG + Intergenic
914650360 1:149693500-149693522 TGGCAGAGAAAGGGTGGGCATGG - Intergenic
915535103 1:156530722-156530744 TCCCAAAGAAAAGGTGGGGATGG - Intronic
915912472 1:159923450-159923472 AGCCAAAGAAAAGGCGGACATGG + Exonic
916055847 1:161068620-161068642 TGCCAAAAACAAGCTGGGCTGGG + Intronic
916191295 1:162180717-162180739 TGCCAACGACAACGTGAGCTTGG + Intronic
916253801 1:162766028-162766050 TGCCATAGGAGAGGTGGGCAGGG - Exonic
916337455 1:163689374-163689396 TTCCAAAGAAAAGGTGGCCTTGG + Intergenic
916380734 1:164207902-164207924 CACTAAAGGCAAGGTGGGCATGG + Intergenic
916526598 1:165616254-165616276 AGCAAAAGACATGGAGGGCAAGG - Intergenic
916856413 1:168754910-168754932 AACCAAAGACATGATGGGCAAGG + Intergenic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
917297782 1:173539926-173539948 TGCCAATTGCAAAGTGGGCATGG - Intronic
917577459 1:176339016-176339038 TGCCCAAGGCAAGGGAGGCAAGG + Intergenic
917807272 1:178625116-178625138 TGCCGATGACAAGGTAGGAAAGG + Intergenic
917830385 1:178877422-178877444 TGACAAAGAAAAGGGGGGAAGGG - Intronic
918019610 1:180673739-180673761 TTCCAAAGACCAGGGTGGCAGGG - Intronic
918296482 1:183161721-183161743 TGCAAAAGACAAGGGGGGGCTGG + Intergenic
918578729 1:186099005-186099027 TACCAAAGACAAGGGAGACAGGG + Intronic
918655165 1:187016694-187016716 TGGTAAAGACAGGGTGGGAATGG + Intergenic
919921303 1:202168100-202168122 TGGCAGAGGTAAGGTGGGCATGG + Intergenic
921193033 1:212726554-212726576 GCCCAGAGACAAGGTGGACAGGG - Intronic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
921935617 1:220793754-220793776 TGACAAAGATAATGTAGGCATGG - Intronic
922137041 1:222839348-222839370 TTCCACAGACAACGTGGGCAGGG - Intergenic
922141554 1:222893458-222893480 TGCCAAAGGCAAGCCAGGCATGG + Intronic
922596228 1:226815565-226815587 TGACAAAGACAAGGAGGGACAGG - Intergenic
923677723 1:236094777-236094799 TGCCAAAAATTAGCTGGGCATGG - Intergenic
924182677 1:241454990-241455012 CACCAAAGGCAAAGTGGGCATGG - Intergenic
1063136679 10:3223159-3223181 TGCCTAACACATTGTGGGCATGG + Intergenic
1064172179 10:13043299-13043321 AGACAAAGATAAGCTGGGCATGG + Intronic
1065606766 10:27426270-27426292 TGCCAAAGACAAGGTGGGTGTGG + Intergenic
1067518793 10:46978784-46978806 AGCCAAAGGCAAGGTGAGCATGG + Intronic
1067643455 10:48073050-48073072 AGCCAAAGGCAAGGTGAGCATGG - Intergenic
1067761881 10:49054542-49054564 TGCCAAAATGAAGGTGGGCATGG + Intronic
1067997274 10:51287641-51287663 TGCCTTAGAGAAGGTGGTCAGGG + Intronic
1069130633 10:64697674-64697696 TGCCAAAGCCTAGGTGGAGAAGG - Intergenic
1069391357 10:67939084-67939106 TGAATAAGACAAGATGGGCAAGG + Intronic
1069624723 10:69860697-69860719 GGCCACAGGCAAGGAGGGCATGG - Intronic
1070324591 10:75379880-75379902 ATCCAAATGCAAGGTGGGCAGGG + Intergenic
1070483826 10:76910965-76910987 TTCCAAAGCCAAGATGGGAATGG - Intronic
1071158111 10:82714799-82714821 TGCCACTGATGAGGTGGGCAAGG - Intronic
1071569055 10:86686499-86686521 TGGGAAAGCCAAGATGGGCAAGG + Intronic
1071692629 10:87838229-87838251 TGAAAAAGACAGGGTGGGCTGGG + Intronic
1072519849 10:96221772-96221794 TGGCAAAGAGAAGCTGAGCAGGG - Intronic
1073027502 10:100498650-100498672 TGCTTAGGACTAGGTGGGCACGG - Intronic
1074077424 10:110141867-110141889 TGCCAAAGCCAAGCTGAGCATGG + Intergenic
1074459573 10:113624963-113624985 TGGCAAGGGCGAGGTGGGCAGGG + Intronic
1074752438 10:116599667-116599689 GGCCGAAGACAAGATGGGCATGG + Intronic
1075675579 10:124293649-124293671 TGCAAAAAAGAGGGTGGGCATGG - Intergenic
1076701421 10:132275202-132275224 GCCCAGAGACATGGTGGGCACGG - Intronic
1077499110 11:2901314-2901336 GGCCAAAGTCCTGGTGGGCAGGG - Intronic
1078432847 11:11301043-11301065 GGGCAAGGACAAGGTAGGCAGGG + Intronic
1078602585 11:12746887-12746909 TGCCACAGACCAGGCGGGCTGGG + Intronic
1079378095 11:19912168-19912190 TGCCAAAGACAAGATGAGCTAGG + Intronic
1081771347 11:45652092-45652114 TGCAAAAGACAGGGAGGGGAAGG + Intronic
1083761114 11:64818273-64818295 TGCTAAAGACAAGGAGGCCCTGG + Intergenic
1084435648 11:69137771-69137793 TGCCCAAGACAGGGCAGGCAGGG + Intergenic
1084899553 11:72299433-72299455 TGCTAGAGACAAGGTAGGTAAGG - Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085404069 11:76251344-76251366 TGCCAAAGTCAAGTCAGGCATGG - Intergenic
1086200112 11:84192438-84192460 TGGCAAAGAAAGGCTGGGCACGG + Intronic
1088990896 11:114952519-114952541 TGACAAAGACAAGTTGGTAAAGG + Intergenic
1089461087 11:118654206-118654228 TGCCACAGACAAGTTGGCCCAGG + Intronic
1090406280 11:126477404-126477426 TGCCAAAGACAATGGGGTCTCGG + Intronic
1091704714 12:2685982-2686004 TTCCAAAGGCAGGGTGTGCAGGG + Intronic
1091711287 12:2742321-2742343 TTCCAAAGGCAGGGTGTGCAGGG + Intergenic
1093424352 12:19011271-19011293 TCCCAAAGTCAAGGTCGGAAGGG - Intergenic
1095909469 12:47411438-47411460 AGCCAAAGTCAGTGTGGGCAGGG - Intergenic
1096362097 12:50996807-50996829 TGCCTTAGTCAAGGTGAGCAAGG - Exonic
1096524029 12:52200146-52200168 TCCCTGAGACATGGTGGGCAAGG - Intergenic
1097003722 12:55900320-55900342 TACCAACTACGAGGTGGGCAAGG + Intergenic
1097885825 12:64728077-64728099 TACAAAAAACAAGCTGGGCATGG - Intronic
1098498084 12:71160109-71160131 TGCAATAGAGAAGGTGGGAAAGG - Intronic
1099714219 12:86270220-86270242 TGCCAAAAATTAGCTGGGCATGG - Intronic
1099729721 12:86484772-86484794 TGCCAAAGGAAATGTGGACATGG + Intronic
1101222416 12:102655221-102655243 TACCAAAGGCAAGGTGGACGTGG + Intergenic
1102591206 12:113958151-113958173 GGCCATGGACACGGTGGGCATGG - Intronic
1103133235 12:118486494-118486516 CCCCAAAGGCAAGTTGGGCATGG + Intergenic
1104864355 12:131944081-131944103 TGCAAAAGATTAGCTGGGCATGG + Exonic
1106229316 13:27809586-27809608 AGGCACAGACAAGGTGGGGAAGG + Intergenic
1106477087 13:30108268-30108290 AGCTAAAGACAACCTGGGCATGG - Intergenic
1107542669 13:41406732-41406754 TGGGAAAGGCCAGGTGGGCAAGG + Intergenic
1108060575 13:46529067-46529089 GGGCAAATAGAAGGTGGGCAGGG - Intergenic
1108576105 13:51792688-51792710 TGGCCAACACAAGCTGGGCACGG - Intronic
1108987105 13:56605552-56605574 AGACAAACACAAGGGGGGCAAGG + Intergenic
1109037868 13:57288593-57288615 GACCAGAGACTAGGTGGGCAGGG + Intergenic
1109516045 13:63443535-63443557 TATCTAAGGCAAGGTGGGCATGG + Intergenic
1109778679 13:67078325-67078347 TACAAAAGAAGAGGTGGGCAAGG - Intronic
1109851935 13:68076265-68076287 TGCCAAAGGCAAGCCAGGCATGG - Intergenic
1110076413 13:71250012-71250034 AGCCACAGGGAAGGTGGGCATGG - Intergenic
1110310567 13:74044554-74044576 TACCAATGGCAAGCTGGGCATGG + Intronic
1110985065 13:81956688-81956710 GGACAAAGAAAATGTGGGCATGG + Intergenic
1111386550 13:87536252-87536274 TGCATAAGACAAGGTGGGGGTGG - Intergenic
1111595532 13:90404988-90405010 TGCCAAGGACATGCTAGGCATGG - Intergenic
1111835629 13:93385295-93385317 TGCCATAGGCGAGGTTGGCAGGG + Intronic
1112327769 13:98454719-98454741 TGCCAAAACCACGGTGGCCATGG - Intronic
1112472214 13:99699535-99699557 TACCAAAAATTAGGTGGGCATGG + Intronic
1112482147 13:99785982-99786004 TGGCAGAGACAAGGTGGAGAGGG - Intronic
1117772000 14:59142955-59142977 TCCCAAAGGCAGGCTGGGCACGG + Intergenic
1118294101 14:64553107-64553129 TACAAAAAACAAGCTGGGCATGG - Intronic
1119205215 14:72788862-72788884 TGCCAAAGACAGTGTGTGAAGGG + Intronic
1119257031 14:73207784-73207806 TGCCAAAGGCAAGCCAGGCATGG + Intronic
1119395287 14:74321792-74321814 TGCAAATGAAAAGCTGGGCACGG - Intronic
1120562830 14:86017984-86018006 TGCCAAAGGCAAGATGGACATGG - Intergenic
1120907370 14:89632390-89632412 TGCTAGTGACAAGGTGGGGATGG + Intronic
1121549685 14:94789412-94789434 TGCCATAGTCATGATGGGCAAGG - Intergenic
1121780416 14:96618605-96618627 TGCCAAAGCCCAGGGGGACAAGG - Intergenic
1122226771 14:100285201-100285223 GGCCAAAGGCCAGGCGGGCAGGG - Intergenic
1122270474 14:100566678-100566700 TGGCCACGACAAGGTGGGCCTGG + Intronic
1122656611 14:103265897-103265919 TGGCAAAGAGAGGCTGGGCATGG - Intergenic
1125872829 15:43117652-43117674 AGCCAAAGACAGGCCGGGCATGG + Intronic
1126078123 15:44932761-44932783 TGTCAAAGACAAGGTGGGTGTGG + Intergenic
1126142347 15:45448712-45448734 GGCCCCAGACAACGTGGGCAGGG - Intronic
1126501478 15:49350811-49350833 AGCCAAAGACAAAGTGAGCTGGG + Intronic
1127857811 15:62967178-62967200 TCACAAAGACAAGGTGCACAGGG + Intergenic
1128111505 15:65079118-65079140 TGGCAAAAACAGGGTGGGCAAGG - Intergenic
1128227153 15:66009904-66009926 TTCTAAAGAAAAGGTGGGTAGGG + Intronic
1129330374 15:74824058-74824080 AGCCAAAGACAGGGTGAGCAGGG - Intronic
1129822840 15:78616473-78616495 TTTCAAAGACAAGGTGAGGAGGG + Intronic
1130120471 15:81043121-81043143 TTCCAAACACATGGTGGTCAGGG + Intronic
1130509223 15:84574652-84574674 TGGAAAAGAAAATGTGGGCATGG + Intergenic
1130765954 15:86871480-86871502 TGCCAAAGAGCATGTGGGAAGGG - Intronic
1133312975 16:4862906-4862928 TCCCATAGTCAAGGTGGGCCTGG + Intronic
1133745390 16:8682610-8682632 GGACAAGGACAAGGTTGGCAGGG - Intronic
1135840450 16:25871374-25871396 TGCCACAGAGAAGGTGCACAAGG + Intronic
1136564840 16:31063696-31063718 AGCCAATGGGAAGGTGGGCATGG - Intronic
1138246609 16:55471267-55471289 TGACAAAACCAAGGAGGGCAGGG + Intronic
1138457665 16:57130740-57130762 TGGCAGAGACAAGATGGGGAGGG + Intronic
1138482231 16:57311054-57311076 AGCCAGAGACACGGTGGGCAGGG + Intergenic
1138851689 16:60636793-60636815 AAACAAAGACAAGCTGGGCATGG + Intergenic
1139955786 16:70692370-70692392 TGCCACAGACAGGGTGGGGAGGG + Intronic
1140680305 16:77378422-77378444 TGCTAAAAACAGGCTGGGCACGG + Intronic
1140750351 16:78017923-78017945 CCCCAAAGACAAGGTGGGGCAGG + Intergenic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1203123952 16_KI270728v1_random:1560153-1560175 TGCCAAAGCCAAGGCTGGCCAGG - Intergenic
1142613144 17:1120048-1120070 TGCCTAAGATTAGCTGGGCATGG - Intronic
1142669446 17:1480955-1480977 TGCCAAAGCCCAGGAGTGCAGGG - Intronic
1142893676 17:2961059-2961081 TGCAAAAAACTAGCTGGGCATGG + Intronic
1143037289 17:4006645-4006667 TGCCTCAGAAAGGGTGGGCAGGG - Exonic
1143349902 17:6280213-6280235 TGCAAAAAACTAGCTGGGCATGG - Intergenic
1144259627 17:13505550-13505572 TGGGAAAGACAAGGTGGGTGAGG + Intronic
1147637697 17:41974116-41974138 CTCCCAACACAAGGTGGGCAGGG + Exonic
1148243409 17:46014525-46014547 TGCCCAAGACAAGGTGAGGCGGG + Intronic
1148809084 17:50279012-50279034 GGCCAGAGGCAAGGTGGGGATGG - Intronic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1152137692 17:78514647-78514669 TGGTAAAGCCAATGTGGGCAGGG - Intronic
1152688828 17:81708241-81708263 TGCCCAAGAAAAGGCGGCCACGG - Intergenic
1152709448 17:81863510-81863532 GGCCTGAGACAAGCTGGGCATGG + Intergenic
1152847796 17:82613319-82613341 CGCCAAACACAGGGTGGGTATGG + Intronic
1153110524 18:1580858-1580880 TGCCAAAGACACACTGGGGATGG + Intergenic
1154273532 18:12940247-12940269 TGCCAAAAGCAAGGAGAGCATGG - Intergenic
1155725021 18:29070618-29070640 AACTAAAGAGAAGGTGGGCAAGG - Intergenic
1155822619 18:30397567-30397589 TACCAATGGCAAGGTGGGCATGG - Intergenic
1157439114 18:47696827-47696849 TGCCAAGGAGAGGGTGGGCAGGG - Intergenic
1157439121 18:47696850-47696872 TGCTAAGGAGAGGGTGGGCAGGG - Intergenic
1157439144 18:47696919-47696941 TGCCGAGGAGAGGGTGGGCAGGG - Intergenic
1157845950 18:51004200-51004222 CATCAAAGGCAAGGTGGGCATGG + Intronic
1158138551 18:54232101-54232123 TTCTATAGAGAAGGTGGGCAAGG - Intergenic
1158227136 18:55213184-55213206 TGCCAAAGGCAAGGTGGGCAAGG - Intergenic
1158397803 18:57093331-57093353 AGCAAAGGACAAGGTGGGCTAGG - Intergenic
1158404610 18:57150201-57150223 TGCCAAACTCATGGTGGGAACGG - Exonic
1158544114 18:58381358-58381380 GGCCACAGACAAAGTGGGGAGGG - Intronic
1160468095 18:79099750-79099772 TGCAAAAAACAGGTTGGGCATGG - Intronic
1161580440 19:5077804-5077826 TGCCAAAGAAACAGAGGGCAGGG + Intronic
1162051447 19:8036333-8036355 TGCCAGAGATAAGGAGGGCTGGG + Intronic
1162183058 19:8883692-8883714 GGAACAAGACAAGGTGGGCAGGG + Intronic
1162632173 19:11937149-11937171 TGCCAAATCCAAGGTTGTCATGG + Intronic
1164305268 19:24000643-24000665 TGGCAATAGCAAGGTGGGCAGGG + Intergenic
1165337850 19:35185036-35185058 TGCCAAAGATAAGGTAAGCATGG + Intergenic
1166099150 19:40560679-40560701 GGCTAAAGACAGGATGGGCAAGG + Intronic
1167894501 19:52570222-52570244 AGCCAACGAGAAGGTGGGCGGGG - Intronic
1168179339 19:54650261-54650283 GGGCACAGACAAGGTGGGAAAGG - Intronic
1168179861 19:54654602-54654624 GGGCAGAGACAAGGTGGGAAAGG - Intronic
925627502 2:5855839-5855861 TTCCTCAGACACGGTGGGCAGGG + Intergenic
926080610 2:9983176-9983198 TGCCAAAGAGAAGATGGGGCCGG - Intronic
926167438 2:10530353-10530375 TGCAAAAAAAAAGCTGGGCACGG - Intergenic
926342118 2:11912195-11912217 CACCAAAGACAAGGTGGGTGTGG - Intergenic
927189663 2:20508957-20508979 TCCCAAAGTCAAGGTTAGCATGG + Intergenic
928202276 2:29255708-29255730 TGAAAAAGACAAGGTGGGTCCGG - Intronic
928800070 2:35078779-35078801 TAGCAAAGAAAAGGTGGGAATGG - Intergenic
928978748 2:37116914-37116936 TTCAAAAGAAAAAGTGGGCAGGG + Intronic
929819191 2:45259738-45259760 CCCCAAAGGGAAGGTGGGCAGGG + Intergenic
932454660 2:71841548-71841570 TGCCAAAGCCAAGGTGGATAGGG - Intergenic
932698396 2:73976252-73976274 TGCCAAAAATTAGCTGGGCATGG - Intergenic
932794052 2:74679975-74679997 GGCTAGAGACAAGGTGGGCCTGG + Exonic
932837806 2:75053595-75053617 TGCCAAGCGCAAGGTGAGCAGGG - Exonic
933043812 2:77507837-77507859 CACCGAAGACAAGGTGAGCATGG + Intronic
933443754 2:82350174-82350196 TCCCAAAGCCGAAGTGGGCATGG - Intergenic
934563774 2:95327223-95327245 CACTACAGACAAGGTGGGCATGG - Intronic
934706740 2:96486454-96486476 TGGCAAAGGCAAGGTGTGCTGGG - Intergenic
936540924 2:113350645-113350667 TGCCAAATATTAGGAGGGCAGGG - Intergenic
937345914 2:121125168-121125190 TGCAAAAAACTAGGTGGGCATGG + Intergenic
938960556 2:136336663-136336685 TGCCAAAGACAAAATGGAGAAGG - Intergenic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
939887919 2:147701343-147701365 TCCCAAATGCAAGGAGGGCAAGG + Intergenic
941222192 2:162796559-162796581 TGTTTAAGACAAGGTGGGTAGGG - Intronic
941530237 2:166660932-166660954 TACCAAAAAAGAGGTGGGCAGGG + Intergenic
941999005 2:171627643-171627665 TGCCAAAGGCAAGCCAGGCAGGG - Intergenic
942007846 2:171724797-171724819 AGCAAAAGAAAAGGTGGGCAGGG + Intronic
942331478 2:174829292-174829314 TGCAAAGGACAGGGTGGGAAAGG + Intronic
942839274 2:180340138-180340160 AGCCACAGCCAAGGTGAGCATGG + Intergenic
942937983 2:181581603-181581625 TGACAGAAACATGGTGGGCAGGG + Intronic
943994776 2:194748187-194748209 TGCCAAAGAAGAGGTGAGCATGG - Intergenic
944626000 2:201569463-201569485 TACCAAAGGCAAGGTGGGCATGG - Intronic
945192502 2:207204333-207204355 CGCCAAAAATTAGGTGGGCATGG + Intergenic
945308240 2:208280913-208280935 CGCCAAAGACAAGGTGGGCATGG - Intronic
945641930 2:212442052-212442074 CATCAAAGGCAAGGTGGGCATGG + Intronic
945780652 2:214167368-214167390 TGCCAATAATTAGGTGGGCATGG + Intronic
946136427 2:217651392-217651414 TGCAAAAAACTAGCTGGGCATGG - Intronic
947977031 2:234375769-234375791 CACCAAAGAGAAGCTGGGCAGGG - Intergenic
948559551 2:238842616-238842638 GGACAAAGACAAGTTGGCCAAGG - Intergenic
1168836589 20:881691-881713 TGGCACAGAGAAGGTGGGGAAGG + Intronic
1169368280 20:5008865-5008887 TTCCAAAGACAAGGGTGGTAGGG - Intronic
1169391419 20:5194361-5194383 GGCCCAAGAGAAGGTGGGCCAGG - Exonic
1170614715 20:17939303-17939325 TCACAAAGAAAAGGTGCGCAAGG + Intergenic
1170731809 20:18982607-18982629 TTCCAAAGACAGGGTCGGAATGG + Intergenic
1171410052 20:24940421-24940443 CACCAAAGACAAGGTGAGAATGG - Intergenic
1172347154 20:34210537-34210559 TGCCAAAGGCAAGCCAGGCATGG - Intronic
1172469229 20:35178939-35178961 TGCCAAGCGCAAGCTGGGCACGG + Intergenic
1173884422 20:46445140-46445162 TGCCAAAGGCAAGTCAGGCATGG + Intergenic
1174102730 20:48139556-48139578 TGCCAAATCCAAGATGGGGATGG - Intergenic
1174662140 20:52222556-52222578 TGCCAGAGAGGAAGTGGGCAAGG - Intergenic
1175766663 20:61597321-61597343 TGCCAAGGAAAAGGAGCGCAGGG - Intronic
1176407719 21:6430483-6430505 TGCCAAACTCAGGGTGGGCGGGG + Intergenic
1178169088 21:30018452-30018474 TGCCAAGGCCAAGATGGACATGG - Intergenic
1178239298 21:30880875-30880897 TGCTAAAGACAGCGTGTGCATGG + Exonic
1179458439 21:41515886-41515908 TGCCAAAGGCAAGGTGGGCATGG - Intronic
1179556645 21:42182847-42182869 GGCCAAGGACACTGTGGGCAAGG - Intergenic
1179873289 21:44254528-44254550 TGCCAAGGATGAGGCGGGCAAGG - Intronic
1181325271 22:22040112-22040134 TGCCTCAGACAAGATGGACAAGG + Intergenic
1181732243 22:24855635-24855657 TGCCATAGAGAAGGGTGGCACGG - Exonic
1182238962 22:28899502-28899524 TTCCAAAAACAAGGTTGGTATGG - Intronic
1182322729 22:29489071-29489093 GGCCAAAGAGGAGGAGGGCAAGG + Exonic
1184445880 22:44546587-44546609 TGAAAAAGACAAGCTGGGCACGG - Intergenic
1184501992 22:44879983-44880005 TGCCAAGGACCAGGTATGCAAGG + Intergenic
1184717798 22:46291662-46291684 TGCCACAGACAGGCCGGGCACGG + Intronic
1184782071 22:46654532-46654554 TGCCACATGCAAGGTTGGCAAGG + Intronic
949670568 3:6395274-6395296 TGCCCAAGACTAAGTGGTCATGG - Intergenic
951147785 3:19249949-19249971 TGGCAAAGGCAAGCTGGGTATGG + Intronic
951536831 3:23747568-23747590 TGAAAAAGACAAGGTTGGCCAGG - Intergenic
951571284 3:24065866-24065888 TGCCAAAGGCAAGATGGGTATGG - Intergenic
952983911 3:38760616-38760638 TGCCAAGGACAAGATGGAGAAGG + Intronic
954563691 3:51580295-51580317 TGCCAAGGACAAGGTATGGAGGG + Intronic
955638528 3:61056533-61056555 TACCCCAGACAAGGTGGTCAGGG + Intronic
957767872 3:84649106-84649128 AGCCAAAGACAGGCTGGGTATGG + Intergenic
958107474 3:89095180-89095202 TTCCAGAGAAAAGCTGGGCAGGG - Intergenic
958460085 3:94383527-94383549 TGCCACAGAGAAGTTGGGGAAGG - Intergenic
959861879 3:111225727-111225749 GGCCAAAGTGAAGGTGGGCATGG + Intronic
959914425 3:111800159-111800181 TTGCAAAAACTAGGTGGGCATGG - Intronic
961365614 3:126397697-126397719 TGGCATGGGCAAGGTGGGCAGGG + Intronic
961622771 3:128237912-128237934 TCCCAAAGAGCAGGTGGGCAAGG - Intronic
962045266 3:131752253-131752275 CAGCAAAGACCAGGTGGGCAGGG - Intronic
962557903 3:136574083-136574105 TACCAAAAATTAGGTGGGCATGG + Intronic
962948863 3:140199579-140199601 TGACAATAACCAGGTGGGCAGGG - Intronic
963190829 3:142471108-142471130 TGCCAGAGACTGGGTGGGGAAGG - Intronic
963381040 3:144530690-144530712 TGCCATAATCAAGATGGGCAAGG + Intergenic
963905976 3:150773991-150774013 TGCCAAGGGCAAGCTGGACACGG + Intergenic
964710010 3:159661829-159661851 TGCCAAAGTCCTGGAGGGCAAGG - Intronic
966043136 3:175516914-175516936 TGGCACATATAAGGTGGGCAAGG - Intronic
966399496 3:179534265-179534287 AGCAAGAGACAATGTGGGCATGG + Intergenic
967092999 3:186151415-186151437 TGTCCAAAACAAGGTGGGCATGG + Intronic
968142822 3:196272980-196273002 TGCCAAGGACAAGCCAGGCACGG + Intronic
970021559 4:11574974-11574996 TGCCAAACACAAGGCCAGCAAGG - Intergenic
970780266 4:19729405-19729427 TTACAAAGATTAGGTGGGCATGG + Intergenic
971229132 4:24784316-24784338 TGACAATGGCAATGTGGGCAAGG - Intergenic
971913738 4:32831624-32831646 TGACAAATACTAGCTGGGCATGG + Intergenic
972286449 4:37653189-37653211 TACCTAAGATAAGGTGAGCATGG - Intronic
972889275 4:43536214-43536236 TGTCAAAAACAAGGTAGGAAAGG + Intergenic
974343768 4:60650826-60650848 TGCCAAAGAAAAGATGGGGCAGG + Intergenic
975498438 4:75058725-75058747 TGCCAAGGGCGAGCTGGGCATGG - Intergenic
976009047 4:80465389-80465411 TGCCAGAGAAAAGAAGGGCAGGG + Intronic
976361956 4:84190186-84190208 TGCAAAGGCCAAGATGGGCAAGG + Intergenic
976922693 4:90457893-90457915 CGGCAAAGAGAAGGTTGGCATGG - Intronic
977036405 4:91958884-91958906 TGCCAAAAGCAAGGTGGGCGTGG + Intergenic
978211307 4:106139268-106139290 TGCCAAATACAAGGTAAACAAGG + Intronic
979282740 4:118885721-118885743 TGGGGAAGACAAGGTGGGCAAGG - Intronic
980601936 4:135037699-135037721 CATCAAAGACAAGGTGGGCATGG + Intergenic
981160746 4:141495779-141495801 CACTAAAGACAAGGTGGGCATGG + Intergenic
981311159 4:143299278-143299300 TGGCAGAGCCAAGGTGGGCAGGG - Intergenic
982843685 4:160223711-160223733 GGCCAGGGACAAGATGGGCAGGG + Intergenic
986089278 5:4488152-4488174 AGCCAAAATCAAGGTGGGCTGGG - Intergenic
987018687 5:13847566-13847588 TGCCAAAAAATAGCTGGGCATGG + Intronic
990263525 5:54050575-54050597 TGCAAAAGAAAATGTGGCCAGGG + Intronic
990528273 5:56650078-56650100 TGCAGAAGACAAGGTGGAAATGG + Intergenic
991234485 5:64378036-64378058 TGCCAAAGATAAGATAGGCAGGG - Intergenic
992397159 5:76378730-76378752 TGCCAAAGATCAGCCGGGCACGG + Intergenic
993705606 5:91166454-91166476 TGCCAAAGTCAGGGTGTCCAAGG - Intergenic
994539338 5:101075133-101075155 AACCAAAGGCAAGATGGGCATGG + Intergenic
994749954 5:103725426-103725448 AGCAAAAGACAGGCTGGGCACGG - Intergenic
997044668 5:130299992-130300014 GGCCAAAGACAACATGTGCATGG + Intergenic
997125859 5:131226108-131226130 TGCCAAAGACAGGATGGGTATGG + Intergenic
997434072 5:133861584-133861606 TGCCAAAGCCATGGTGGGGGTGG - Intergenic
997460759 5:134050820-134050842 TGGCAGAGTCAAGGTGGGGATGG + Intergenic
999845731 5:155477646-155477668 TGCAGAAGTCAAGGTAGGCAAGG - Intergenic
1000061085 5:157655714-157655736 TGCCTGAGGCAAGGTGGGGAAGG - Intronic
1002162738 5:177325631-177325653 CGCCAAAAACTAGCTGGGCATGG + Intergenic
1006022990 6:31128508-31128530 TGCAAAAGGAAAGGTGGGGATGG + Intronic
1007726445 6:43919016-43919038 TGCCAAAGATGGGCTGGGCATGG + Intergenic
1008056498 6:46951192-46951214 AGCTGTAGACAAGGTGGGCATGG + Intronic
1008079588 6:47180134-47180156 TGTCAAAGGCAGGGTGGGCATGG - Intergenic
1009035877 6:58116595-58116617 TACCAAAGACAAGGTGGAATGGG + Intergenic
1010142135 6:72623188-72623210 TGCCACGGAGAAGGTGGCCAAGG + Intronic
1011213622 6:84981305-84981327 GGCAGAAGACAAGGTGGGAATGG + Intergenic
1012033203 6:94099270-94099292 CACCAAAGGCAAGGTGGGCGTGG + Intergenic
1013601141 6:111705946-111705968 TGCCAAAGAAAAGATGTACAGGG - Intronic
1015385584 6:132619252-132619274 GGCCCAACACAAGGAGGGCATGG - Intronic
1015836307 6:137423986-137424008 TGCTCAAAACAAGGTGGGCTGGG - Intergenic
1016524410 6:144985361-144985383 AATCAAAGACAAGCTGGGCATGG - Intergenic
1016571208 6:145515118-145515140 AGCCAAAGACAAGAAGGGTATGG + Intronic
1017044348 6:150333547-150333569 CACCAAAGGCAAGGTGGGCGTGG - Intergenic
1017815909 6:158016698-158016720 TGCCAAAGACCCGGCAGGCAAGG + Intronic
1017983649 6:159423999-159424021 TGACAAAGACAATGTGAACAGGG + Intergenic
1019085473 6:169471652-169471674 TGGAAAAGCCAAGGTGGTCAGGG - Intronic
1020282425 7:6656279-6656301 GGCCAAGGGCAAGGTGGGCTTGG + Exonic
1020387571 7:7624784-7624806 TGCAAAAAATTAGGTGGGCATGG - Intergenic
1021571432 7:22069098-22069120 TGCAAAAAATTAGGTGGGCAAGG + Intergenic
1023095916 7:36659567-36659589 TGGGAAAGAAAAAGTGGGCAGGG + Intronic
1023939502 7:44760624-44760646 TGACAAGGCCAGGGTGGGCATGG + Intronic
1024439802 7:49403975-49403997 TCCCAAAGAGAAAGTGAGCAAGG - Intergenic
1024701493 7:51908443-51908465 TGCCAAAGTCATGGTGGGGCTGG + Intergenic
1027222957 7:76225583-76225605 TGCCAGAGACAAGGGGAGCAGGG + Intronic
1027644472 7:80779967-80779989 TGCCAAAAACCAGGTGGGTTTGG + Intronic
1027720803 7:81739233-81739255 TGAGAAAAACAAGGTGGGGAAGG - Intronic
1027893819 7:84014758-84014780 CAGCAAAGACTAGGTGGGCAGGG + Intronic
1029262440 7:99312454-99312476 CTCCAAAGACTAGGAGGGCAAGG - Intergenic
1029312191 7:99677728-99677750 TGCCAAAGCCAGGGTGGCCTTGG + Intronic
1030797956 7:113813181-113813203 TCCCAAAGATAGAGTGGGCAAGG + Intergenic
1031778890 7:125938414-125938436 TGGCAAAGACAGCGTGTGCAGGG - Intergenic
1031836907 7:126690265-126690287 TGCCAAGGGCAAGGCAGGCACGG + Intronic
1032825878 7:135567339-135567361 TGGGAAGGCCAAGGTGGGCAGGG + Intronic
1033161709 7:139002501-139002523 TGCCTGAGGCAAGGTGGGAAAGG - Intergenic
1033864697 7:145674247-145674269 TGCCAAAGGAAAAATGGGCAAGG - Intergenic
1035309405 7:157955684-157955706 AGAGAAAGACAAGGAGGGCAAGG + Intronic
1036182820 8:6599495-6599517 TGCCAAAGAAAATGTTGGAATGG + Intronic
1036687007 8:10918460-10918482 TGCCATGGCCAAGCTGGGCATGG - Intronic
1036752834 8:11454199-11454221 TGCCAAAGCCAGGGTGGGCTTGG + Intronic
1038369349 8:26972577-26972599 GGCCGTAGGCAAGGTGGGCATGG + Intergenic
1039501807 8:38023651-38023673 GGCCAAAGAAAAGGAGGGCCAGG - Intergenic
1040687285 8:49890218-49890240 AGGCAAAGACAGGCTGGGCATGG + Intergenic
1040726493 8:50387161-50387183 TGGCAAAGACAAAGAGGCCATGG - Intronic
1041803223 8:61822493-61822515 TGCCTCAGACAAGGTGGGTGTGG - Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044233750 8:89807403-89807425 GGCGAAAGTCAAGGTCGGCAGGG - Intergenic
1044559812 8:93601893-93601915 GACCAAGGACAAGGTGGGAAAGG + Intergenic
1045374727 8:101559844-101559866 CGCCAAATGCAAGGTGAGCAGGG - Intronic
1045440935 8:102209985-102210007 TGCCTAAGGCAAGGTGGGTAAGG + Intronic
1045826391 8:106403333-106403355 TGTCACAGGCAAGGTGGGCAGGG - Intronic
1046216979 8:111161514-111161536 TGCCAAAGACAAGGTGGACCTGG + Intergenic
1047690148 8:127343800-127343822 AGCCATAGACAATGTGGCCAAGG + Intergenic
1048999411 8:139815232-139815254 TGCCACAGGGAAGGCGGGCAGGG - Intronic
1049033769 8:140058587-140058609 AGACAAAGACAAGCTGGGCAGGG + Intronic
1051245653 9:15108324-15108346 TGAAAAAGAAAAGGTGGGTAGGG + Intergenic
1051721462 9:20041702-20041724 AGCCAAAGGAAAGATGGGCAGGG + Intergenic
1052364260 9:27594312-27594334 TGCCAAAGCCAACGTGGAGAAGG - Intergenic
1052730578 9:32280511-32280533 TGCTAAAGAGAAGGTAGGGAGGG - Intergenic
1053000235 9:34573936-34573958 GGACAAGGACATGGTGGGCAGGG + Intronic
1053156035 9:35780057-35780079 TGCCAAACAACAGGTTGGCATGG + Intergenic
1054792624 9:69270033-69270055 TGCCAAAGACATGGTGAGCACGG - Intergenic
1056150632 9:83784109-83784131 TACAAAAGACTAGTTGGGCATGG + Intronic
1057149290 9:92782056-92782078 TGCCAAAGGCAAGGTGGGTGGGG + Intergenic
1057558753 9:96110797-96110819 TGCCACAGACTAGGTGGAAAAGG - Intronic
1057648033 9:96895217-96895239 CACCAAAGACAAGGTGAACATGG + Intergenic
1058905841 9:109481912-109481934 TGACAAAGACAGGGAGGGCTGGG + Intronic
1059115217 9:111595143-111595165 TACCAAAAACAGGCTGGGCATGG - Intronic
1059337749 9:113579921-113579943 TGCAGAACACATGGTGGGCATGG - Intronic
1059347508 9:113639664-113639686 TACCAAAGATTAGCTGGGCATGG + Intergenic
1060585334 9:124782081-124782103 TGCCAAGGGCAGGGTGGGCTGGG + Intronic
1060805367 9:126572456-126572478 TGCCAAAGGCAAGGTGGGCGTGG - Intergenic
1060913128 9:127366711-127366733 TCCCAAAGAAAAAGAGGGCATGG + Intronic
1061545263 9:131300800-131300822 GGCCAAAGGCAAGGAGGGCTGGG - Intronic
1185455424 X:307972-307994 TCCCAACGACAGGCTGGGCATGG + Intronic
1187263983 X:17714020-17714042 TGTCAGGGACAAGATGGGCATGG + Intronic
1187459594 X:19474980-19475002 TTCCACGGACCAGGTGGGCAGGG + Intronic
1188360871 X:29251764-29251786 TGAGAGAGACAAGGTGGGAATGG + Intronic
1189974952 X:46451359-46451381 TGCAAAAGGCAAGATGGGTATGG - Intronic
1190538154 X:51449430-51449452 CACCAAAGGCAAGGTGGACATGG + Intergenic
1191204341 X:57818577-57818599 TCCCTAAGACAAGCTGGGAAGGG - Intergenic
1192845441 X:74902589-74902611 TGGAAAAGACAAGAGGGGCAAGG - Intronic
1193187197 X:78527470-78527492 TATCAAAGACAAGGTGGCCATGG + Intergenic
1193231646 X:79053813-79053835 TGCCAATGACAAGATGGGCATGG - Intergenic
1193543236 X:82796327-82796349 CACCAAAGACAAGGTGGACTTGG + Intergenic
1193966813 X:87997766-87997788 TACTAAAGGCAAGGTTGGCATGG + Intergenic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1197387037 X:125814451-125814473 AGTCAAAGGCAAAGTGGGCATGG - Intergenic
1197504854 X:127289100-127289122 TGCCAAAGTCAAGGTAGGTATGG - Intergenic
1199008263 X:142728683-142728705 CACCAAAGGCAAGGTGGGCATGG + Intergenic
1199843185 X:151671496-151671518 GGCATAAGACAAGCTGGGCATGG - Intronic
1200806386 Y:7437651-7437673 TACAAAAAACAAGCTGGGCATGG - Intergenic
1201303277 Y:12528704-12528726 TGCCAAAGCCAAGGATGGGATGG - Intergenic