ID: 939755375

View in Genome Browser
Species Human (GRCh38)
Location 2:146103008-146103030
Sequence GCAGCTGGTGCCACCCATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939755375_939755378 -6 Left 939755375 2:146103008-146103030 CCGGTATGGGTGGCACCAGCTGC No data
Right 939755378 2:146103025-146103047 AGCTGCTCCATCAGAAGGTATGG No data
939755375_939755380 25 Left 939755375 2:146103008-146103030 CCGGTATGGGTGGCACCAGCTGC No data
Right 939755380 2:146103056-146103078 ATACCACAAACACCAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939755375 Original CRISPR GCAGCTGGTGCCACCCATAC CGG (reversed) Intergenic
No off target data available for this crispr