ID: 939755612

View in Genome Browser
Species Human (GRCh38)
Location 2:146105525-146105547
Sequence GCTCAAGTATGTGCACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939755612_939755616 7 Left 939755612 2:146105525-146105547 CCTCTTAGTGCACATACTTGAGC No data
Right 939755616 2:146105555-146105577 CAAAACTCCGGAGATCTTATTGG No data
939755612_939755617 8 Left 939755612 2:146105525-146105547 CCTCTTAGTGCACATACTTGAGC No data
Right 939755617 2:146105556-146105578 AAAACTCCGGAGATCTTATTGGG No data
939755612_939755613 -5 Left 939755612 2:146105525-146105547 CCTCTTAGTGCACATACTTGAGC No data
Right 939755613 2:146105543-146105565 TGAGCCCACTCACAAAACTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939755612 Original CRISPR GCTCAAGTATGTGCACTAAG AGG (reversed) Intergenic
No off target data available for this crispr