ID: 939759229

View in Genome Browser
Species Human (GRCh38)
Location 2:146153747-146153769
Sequence TAAATATTTAAAGGATACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939759229_939759236 26 Left 939759229 2:146153747-146153769 CCTAGGTATCCTTTAAATATTTA No data
Right 939759236 2:146153796-146153818 TATTTTGGAACTTAGCTTTATGG No data
939759229_939759233 2 Left 939759229 2:146153747-146153769 CCTAGGTATCCTTTAAATATTTA No data
Right 939759233 2:146153772-146153794 AAGTACCTATTGTACTCTAGGGG No data
939759229_939759232 1 Left 939759229 2:146153747-146153769 CCTAGGTATCCTTTAAATATTTA No data
Right 939759232 2:146153771-146153793 TAAGTACCTATTGTACTCTAGGG No data
939759229_939759235 11 Left 939759229 2:146153747-146153769 CCTAGGTATCCTTTAAATATTTA No data
Right 939759235 2:146153781-146153803 TTGTACTCTAGGGGATATTTTGG No data
939759229_939759231 0 Left 939759229 2:146153747-146153769 CCTAGGTATCCTTTAAATATTTA No data
Right 939759231 2:146153770-146153792 TTAAGTACCTATTGTACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939759229 Original CRISPR TAAATATTTAAAGGATACCT AGG (reversed) Intergenic
No off target data available for this crispr