ID: 939759233

View in Genome Browser
Species Human (GRCh38)
Location 2:146153772-146153794
Sequence AAGTACCTATTGTACTCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939759229_939759233 2 Left 939759229 2:146153747-146153769 CCTAGGTATCCTTTAAATATTTA No data
Right 939759233 2:146153772-146153794 AAGTACCTATTGTACTCTAGGGG No data
939759230_939759233 -7 Left 939759230 2:146153756-146153778 CCTTTAAATATTTATTAAGTACC No data
Right 939759233 2:146153772-146153794 AAGTACCTATTGTACTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939759233 Original CRISPR AAGTACCTATTGTACTCTAG GGG Intergenic
No off target data available for this crispr