ID: 939761348

View in Genome Browser
Species Human (GRCh38)
Location 2:146184734-146184756
Sequence AGACCTGGGTTTTTCCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939761344_939761348 -8 Left 939761344 2:146184719-146184741 CCTGTAAAACCATCTAGACCTGG No data
Right 939761348 2:146184734-146184756 AGACCTGGGTTTTTCCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939761348 Original CRISPR AGACCTGGGTTTTTCCAACA AGG Intergenic
No off target data available for this crispr