ID: 939763555

View in Genome Browser
Species Human (GRCh38)
Location 2:146216108-146216130
Sequence CTAGAATCAGAAATGGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939763553_939763555 9 Left 939763553 2:146216076-146216098 CCTAATGACATAAGAAAAAAAAA No data
Right 939763555 2:146216108-146216130 CTAGAATCAGAAATGGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939763555 Original CRISPR CTAGAATCAGAAATGGAGAA TGG Intergenic
No off target data available for this crispr