ID: 939765225

View in Genome Browser
Species Human (GRCh38)
Location 2:146240013-146240035
Sequence GGTTAGACCTTCAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939765225_939765231 -3 Left 939765225 2:146240013-146240035 CCTTTCTCCCTGAAGGTCTAACC No data
Right 939765231 2:146240033-146240055 ACCTGGTGGGAACCTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939765225 Original CRISPR GGTTAGACCTTCAGGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr