ID: 939766753

View in Genome Browser
Species Human (GRCh38)
Location 2:146260203-146260225
Sequence CTAAATATAAAGAAGAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939766753_939766758 20 Left 939766753 2:146260203-146260225 CCCAGCTTCTTCTTTATATTTAG No data
Right 939766758 2:146260246-146260268 ATCCTCCTCCCTTAGGAAAAAGG No data
939766753_939766757 13 Left 939766753 2:146260203-146260225 CCCAGCTTCTTCTTTATATTTAG No data
Right 939766757 2:146260239-146260261 CTGTAAGATCCTCCTCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939766753 Original CRISPR CTAAATATAAAGAAGAAGCT GGG (reversed) Intergenic
No off target data available for this crispr