ID: 939776348

View in Genome Browser
Species Human (GRCh38)
Location 2:146392498-146392520
Sequence GGGTCGCGGGTGAAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939776348_939776360 4 Left 939776348 2:146392498-146392520 CCCCCCAACTTCACCCGCGACCC No data
Right 939776360 2:146392525-146392547 AACTGCTGCTCCTGTCTTGCGGG No data
939776348_939776363 26 Left 939776348 2:146392498-146392520 CCCCCCAACTTCACCCGCGACCC No data
Right 939776363 2:146392547-146392569 GATTTGCCACCTGTGCTTGGAGG No data
939776348_939776362 23 Left 939776348 2:146392498-146392520 CCCCCCAACTTCACCCGCGACCC No data
Right 939776362 2:146392544-146392566 CGGGATTTGCCACCTGTGCTTGG No data
939776348_939776359 3 Left 939776348 2:146392498-146392520 CCCCCCAACTTCACCCGCGACCC No data
Right 939776359 2:146392524-146392546 TAACTGCTGCTCCTGTCTTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939776348 Original CRISPR GGGTCGCGGGTGAAGTTGGG GGG (reversed) Intergenic
No off target data available for this crispr