ID: 939788491

View in Genome Browser
Species Human (GRCh38)
Location 2:146544732-146544754
Sequence ATGCTGACTCAGAGCATACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939788489_939788491 10 Left 939788489 2:146544699-146544721 CCTGGCTATGGGAGAAACAGTAG No data
Right 939788491 2:146544732-146544754 ATGCTGACTCAGAGCATACATGG No data
939788488_939788491 19 Left 939788488 2:146544690-146544712 CCTGTGAATCCTGGCTATGGGAG 0: 125
1: 202
2: 185
3: 155
4: 259
Right 939788491 2:146544732-146544754 ATGCTGACTCAGAGCATACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939788491 Original CRISPR ATGCTGACTCAGAGCATACA TGG Intergenic
No off target data available for this crispr