ID: 939788682

View in Genome Browser
Species Human (GRCh38)
Location 2:146546097-146546119
Sequence CTTGGCCTGTTACTGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939788682_939788688 22 Left 939788682 2:146546097-146546119 CCAAACCCCAGTAACAGGCCAAG No data
Right 939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG No data
939788682_939788689 23 Left 939788682 2:146546097-146546119 CCAAACCCCAGTAACAGGCCAAG No data
Right 939788689 2:146546143-146546165 GTTATCTGCAGAAGATGCCAGGG No data
939788682_939788686 -6 Left 939788682 2:146546097-146546119 CCAAACCCCAGTAACAGGCCAAG No data
Right 939788686 2:146546114-146546136 GCCAAGAGTTGTCTCTCAAAAGG 0: 17
1: 192
2: 177
3: 161
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939788682 Original CRISPR CTTGGCCTGTTACTGGGGTT TGG (reversed) Intergenic
No off target data available for this crispr