ID: 939788683

View in Genome Browser
Species Human (GRCh38)
Location 2:146546102-146546124
Sequence CAACTCTTGGCCTGTTACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939788683_939788688 17 Left 939788683 2:146546102-146546124 CCCCAGTAACAGGCCAAGAGTTG No data
Right 939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG No data
939788683_939788689 18 Left 939788683 2:146546102-146546124 CCCCAGTAACAGGCCAAGAGTTG No data
Right 939788689 2:146546143-146546165 GTTATCTGCAGAAGATGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939788683 Original CRISPR CAACTCTTGGCCTGTTACTG GGG (reversed) Intergenic
No off target data available for this crispr