ID: 939788686

View in Genome Browser
Species Human (GRCh38)
Location 2:146546114-146546136
Sequence GCCAAGAGTTGTCTCTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 17, 1: 192, 2: 177, 3: 161, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939788682_939788686 -6 Left 939788682 2:146546097-146546119 CCAAACCCCAGTAACAGGCCAAG No data
Right 939788686 2:146546114-146546136 GCCAAGAGTTGTCTCTCAAAAGG 0: 17
1: 192
2: 177
3: 161
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939788686 Original CRISPR GCCAAGAGTTGTCTCTCAAA AGG Intergenic
901444629 1:9300550-9300572 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
901904049 1:12392658-12392680 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
904335934 1:29798012-29798034 GCCAAGAGCTGTCTCTCAAGAGG - Intergenic
904346961 1:29879031-29879053 GCCCAGAGGTTTCTCTCAGAGGG + Intergenic
904419578 1:30383023-30383045 GCCAGGAGCTATTTCTCAAAAGG + Intergenic
904625873 1:31801834-31801856 GCAAAAAGTTGTCCATCAAAGGG + Intronic
904846709 1:33424593-33424615 CCCAAAACTTGTTTCTCAAAGGG + Intronic
905465226 1:38148125-38148147 GCTAAGAGCTGTTTCTCAAAAGG - Intergenic
905516302 1:38564501-38564523 GCTTAGAGTTGGCTCTCCAAAGG + Intergenic
905877148 1:41439457-41439479 GCCAGGAACTGTTTCTCAAAAGG - Intergenic
906884319 1:49628114-49628136 GCCAGGAGCTGTTTCTCAAAAGG + Intronic
907780343 1:57560860-57560882 GCCAAGAGCTGACTCTCAAAAGG - Intronic
908143706 1:61214872-61214894 GCCAAGACCTGTTTCACAAATGG - Intronic
908895426 1:68893315-68893337 GTTATGAGTTGTCTATCAAATGG - Intergenic
909278735 1:73722149-73722171 ACCAAGAGCTGACTCTCAAAAGG - Intergenic
909576922 1:77185884-77185906 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
909781254 1:79550363-79550385 GCCAAGAGCTGTTTATCAAAAGG - Intergenic
910370636 1:86512154-86512176 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
910588217 1:88901752-88901774 GACAAGAGCTGTCTCTCAAAAGG - Intergenic
910630223 1:89346278-89346300 GCCAAGAGCTGCCTCTCAGAAGG - Intergenic
910638989 1:89439948-89439970 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
910790323 1:91043746-91043768 GCCAACAGCTGTCTCTCAAAAGG - Intergenic
910831096 1:91463398-91463420 GCCAAGAGCTATCTCTCAAAAGG + Intergenic
910948216 1:92616714-92616736 GCCAACAGCTGTCTCTCAAAAGG - Intronic
911109096 1:94164179-94164201 GCCAAGAGTTGTCTCTCAAATGG + Intronic
911245324 1:95510362-95510384 GGCAAGTGTTGTCTCTTAGAAGG + Intergenic
911257323 1:95647338-95647360 GCCAAGAGCTGCCTCTCAAAAGG + Intergenic
911738396 1:101361893-101361915 GCCAAGAGCTGTGTCTCAAAAGG + Intergenic
911883575 1:103270475-103270497 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
911980428 1:104559447-104559469 GCCAAGAGTTGTCTCTCAAAAGG - Intergenic
912129910 1:106588024-106588046 GCCAAGAGTTGTCTCTTAAAAGG + Intergenic
912212254 1:107568920-107568942 TCCAAGAGCTGTCTCTCAAAAGG - Intergenic
912252028 1:108021362-108021384 CCCAAGAGCTGTCTCTCAAAAGG + Intergenic
912730626 1:112099808-112099830 ACCAGGAGCTGTCTTTCAAATGG - Intergenic
912733321 1:112128803-112128825 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
912943811 1:114068178-114068200 GCTAAAAGCTGTCTCTCAAAAGG + Intergenic
913039445 1:115008369-115008391 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
915346654 1:155200974-155200996 GCCCAGAGTTGGGTGTCAAAAGG + Exonic
915667669 1:157459617-157459639 ACCAAGAGCTGTCTCTCAAAAGG + Intergenic
916017356 1:160761966-160761988 GCCAAGTGCTCTTTCTCAAAAGG + Intergenic
916106328 1:161435301-161435323 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
916285318 1:163099554-163099576 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
916365966 1:164028061-164028083 ACCAAGAGCTGTTTCTCAAAAGG + Intergenic
917217212 1:172690887-172690909 ACCAAGAGCTGCCTCTCAAAAGG + Intergenic
917274621 1:173319032-173319054 GCCAAGTGTTCTCTCTCAGCAGG + Intergenic
917462709 1:175246209-175246231 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
917864405 1:179179680-179179702 GCCAAGAGTCCTCTTTCAAGAGG - Intronic
918007624 1:180556833-180556855 ACCAAGAGCTGTTTTTCAAAGGG - Intergenic
918575770 1:186057605-186057627 GCCAAGATTTGTTTTTTAAAGGG - Intronic
918755712 1:188337783-188337805 GCCAAGAGCCATCTCTCAAAAGG + Intergenic
918774494 1:188610773-188610795 GCAAAGAGATGTCTCTCAAAAGG - Intergenic
918918230 1:190671853-190671875 GCCAAGAGCTGTCTCTCAGAAGG + Intergenic
918958247 1:191237975-191237997 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
919241774 1:194924230-194924252 GCCAATAGCTGTCTCTCAAAAGG - Intergenic
919264880 1:195250416-195250438 GCCATAAGTTAACTCTCAAAAGG - Intergenic
919317975 1:195999388-195999410 GCCAAAAGCTATCCCTCAAAAGG - Intergenic
920197432 1:204238392-204238414 ACCAACAGGTGTCTCTCAAAAGG - Intronic
921619821 1:217313163-217313185 ACCAAGAGCTGTCTCTCAAAAGG - Intergenic
921912210 1:220561977-220561999 GCCAAATGTTCTCTCTTAAAAGG - Intronic
923253568 1:232199411-232199433 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
924477397 1:244394175-244394197 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
924491845 1:244545606-244545628 GCCAAGAATTGTCTCCTAAAAGG - Intronic
924840775 1:247707806-247707828 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
924847132 1:247785112-247785134 CCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1063814393 10:9756243-9756265 ACTAACAGCTGTCTCTCAAATGG + Intergenic
1064517641 10:16168230-16168252 GGCAAGAGCTGTCACTCAAAAGG + Intergenic
1064545687 10:16448109-16448131 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1065379290 10:25073176-25073198 CCCATGAGTTGTGTCTCACATGG - Intergenic
1065607021 10:27428533-27428555 GACAAAAGCTGTTTCTCAAAAGG - Intergenic
1066156049 10:32679212-32679234 GCCAATAATTGTCTCTTAAAGGG + Intronic
1066167026 10:32799204-32799226 GCCAAGAGCTGACTCTCAAAAGG + Intronic
1066169428 10:32826344-32826366 GACAAGAGGTGTCTCTCAAAAGG - Intronic
1066957623 10:42188079-42188101 GACAAGAGCTGTCTCTCAAAAGG - Intergenic
1067125552 10:43512518-43512540 GCCAAGAACTGTCTCTCATAAGG + Intergenic
1067754347 10:48993693-48993715 ACCAAGAGCTGTTTCTCAAAAGG + Intergenic
1068007672 10:51409544-51409566 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1068447211 10:57138619-57138641 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1068459758 10:57312096-57312118 GCCAAGAGTTGTCACTAACATGG - Intergenic
1068837215 10:61568352-61568374 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1068908868 10:62357310-62357332 GCCAAGAGCTGTCTCTCAACAGG - Intergenic
1069145764 10:64890466-64890488 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1069192304 10:65506344-65506366 GCCAAGGGCTGTCTCTCAAAAGG + Intergenic
1069790830 10:71019557-71019579 GCCAAGGGCTGTCTCTCAAAAGG + Intergenic
1071013896 10:80971699-80971721 GCCAAAAGCTGTTTCTCAGATGG + Intergenic
1071267085 10:83973976-83973998 GCCAAGGGCTGTCTCTTAAAAGG + Intergenic
1071364467 10:84884495-84884517 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1071378385 10:85033383-85033405 GCCAAGAGCTATCTCTCAAAAGG - Intergenic
1071673926 10:87637403-87637425 GCCAAAAGCTGTCTCTCAAAAGG + Intergenic
1071942784 10:90607752-90607774 GCCAAGGGCGGTCTCTCAAAAGG + Intergenic
1071947085 10:90657705-90657727 ACCAAGAGCTATCTCTCAAAAGG + Intergenic
1071950798 10:90700911-90700933 GCCAAAAGCTGTCTTTCAAAAGG + Intergenic
1072193365 10:93094097-93094119 GCCAAAAGTTATCTCAGAAAGGG + Intergenic
1072209257 10:93231652-93231674 GCCAAGATCTGTCTCTCAAAAGG + Intergenic
1072360470 10:94654169-94654191 TCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1072400597 10:95095720-95095742 TCCAAGACTTGACTCTTAAATGG - Intergenic
1073557350 10:104465926-104465948 ACCAAGAGCTGTCTCTCAAAAGG - Intergenic
1073918475 10:108432289-108432311 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1073957681 10:108891627-108891649 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1073966710 10:108998627-108998649 GCCTAGAGTTGTCCATCAGATGG + Intergenic
1073995872 10:109314691-109314713 GCCAAGAGCTATCTCTCAAAAGG + Intergenic
1075606790 10:123817425-123817447 GCCAAGTGCTGTCTCTCAAAAGG - Intronic
1076123292 10:127953371-127953393 GCCAAGAGTTGTCTCTCAAAAGG - Intronic
1076657544 10:132034965-132034987 GCCAGCAGCTGTTTCTCAAAAGG - Intergenic
1076772628 10:132674813-132674835 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1076927415 10:133499200-133499222 GCTAAGAGCTGTCTCTCAAAAGG + Intergenic
1077381081 11:2237929-2237951 GCCAAGCCCTGTCTCTCCAAAGG - Intergenic
1078195294 11:9132119-9132141 GCCAGGAACTGTTTCTCAAAAGG - Intronic
1079359026 11:19754965-19754987 GGCAAGAGTTGGCTAACAAAGGG - Intronic
1080076594 11:28157521-28157543 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1080787555 11:35489515-35489537 TACAAGAGTTATCTGTCAAATGG + Intronic
1080976681 11:37350598-37350620 GCCAAAAGCTGTCTCTCAAAAGG - Intergenic
1081072777 11:38631121-38631143 GCCAAGAAATGTCTCTCAAAAGG - Intergenic
1081110478 11:39128419-39128441 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1081609062 11:44547878-44547900 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1082671700 11:56043042-56043064 GCAAAGAGCTATCTCTCAAAAGG - Intergenic
1085079267 11:73620722-73620744 GCCAAGAGCTGTTTCTCAAAAGG - Intergenic
1085685963 11:78622190-78622212 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1085747571 11:79128240-79128262 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1086031027 11:82355775-82355797 GACAAGAGTAGAGTCTCAAATGG + Intergenic
1086278613 11:85160452-85160474 GCCAAGAGCTGTTTCTCAAAAGG - Intronic
1086834116 11:91600393-91600415 GCCAAGAGCTGTCTCCCAAAAGG - Intergenic
1087374022 11:97320554-97320576 GCCAAGAGGTGTCTCTCAAAAGG - Intergenic
1088029103 11:105224493-105224515 GCCAATGGTTGGCACTCAAAGGG + Intergenic
1088097205 11:106115158-106115180 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1088407611 11:109498662-109498684 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1088607652 11:111546807-111546829 GCCAGGAATTGTTTCTCAAAAGG + Intronic
1088836656 11:113583389-113583411 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1089416884 11:118299551-118299573 GCCAAGAGCTGCTTTTCAAATGG - Intergenic
1089463032 11:118663881-118663903 GCTAGTAATTGTCTCTCAAATGG - Intronic
1090209492 11:124908050-124908072 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1090221615 11:125031585-125031607 GCTAAGAGCTGTCTCTCAAAAGG + Intronic
1090575130 11:128094203-128094225 GCCAAGAGCTGACTCTCAGAGGG - Intergenic
1091051740 11:132378756-132378778 GCCAAAAGCTGCCTCTCAAAAGG - Intergenic
1091212418 11:133873525-133873547 GCCAAAAGCTGTTTCTCAAAAGG - Intergenic
1092093284 12:5821651-5821673 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1092381561 12:8000939-8000961 ACCAGGAGCTGTCTCTCAAAAGG - Intergenic
1093036337 12:14335684-14335706 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1093048923 12:14484967-14484989 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1093049670 12:14490962-14490984 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1093392083 12:18635534-18635556 GTCAAGAGCTATTTCTCAAAAGG + Intronic
1093713689 12:22356433-22356455 GGCAGTAATTGTCTCTCAAAGGG + Intronic
1093964541 12:25310957-25310979 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1094102530 12:26779263-26779285 ACCAAGAGCTGTCTCTCCAAAGG - Intronic
1094127420 12:27037917-27037939 GCCAAGAGTTTTTTCATAAATGG - Intronic
1095263648 12:40127931-40127953 ACAAAGAGTTTTCTCTTAAATGG - Intergenic
1095603854 12:44044335-44044357 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1095844395 12:46729967-46729989 GCCAAGAGCTGTTGCTCAAAAGG + Intergenic
1095856240 12:46863674-46863696 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1096457466 12:51799436-51799458 GCCAAGAGCCGTCCCTCAAAAGG + Intronic
1096734788 12:53644201-53644223 GCCAAGAGCTACTTCTCAAAAGG - Intronic
1096758274 12:53818149-53818171 GCCAAGAAGTGTCACTCTAAAGG + Intergenic
1097077000 12:56402442-56402464 GTCAAGAGCTGTCTCTCAAAAGG - Intergenic
1097437838 12:59572253-59572275 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1097564648 12:61252428-61252450 GTCAAGAGCTGTCTCTCAAAAGG + Intergenic
1097821341 12:64131863-64131885 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1097843357 12:64342760-64342782 GCCAAGAGCTGTTTCTCAAAAGG + Intronic
1098198496 12:68028380-68028402 CCCAAGAGTTCTCTTTCATAAGG + Intergenic
1098673041 12:73254245-73254267 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1098716090 12:73829816-73829838 GCCAAGAACTGTCTCTCAAAAGG - Intergenic
1098731051 12:74037349-74037371 GCCAACAGCTGTCTCTCAAAAGG - Intergenic
1098733292 12:74065632-74065654 GCCAAGAGCTTTCTCTCCAAAGG - Intergenic
1098749846 12:74279592-74279614 GCTAAGAGCTATCTCTGAAAAGG - Intergenic
1098807196 12:75034974-75034996 TCCAAGAGCTGTTTCTTAAAAGG - Intergenic
1098870138 12:75808354-75808376 GCCAACAGTGGTGTGTCAAATGG + Intergenic
1099183379 12:79492587-79492609 GCCAAGAGCTGTCTCTCAAAGGG + Intergenic
1099365924 12:81765385-81765407 GCCAAGAGCTGTCTCTCGAAAGG - Intergenic
1099482105 12:83180859-83180881 ACAAAAAGTTCTCTCTCAAATGG + Intergenic
1099508561 12:83507188-83507210 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1099578076 12:84405392-84405414 GCCAAAAGCTGCCTCTCAAAAGG - Intergenic
1099689780 12:85938038-85938060 ACAAAGAGCTGTCTCTCAAAAGG - Intergenic
1099813737 12:87619265-87619287 GCTAAGAGGTGTTTCTTAAAAGG + Intergenic
1099995065 12:89769529-89769551 GCCAAGAGGTATTTCTCAAAAGG + Intergenic
1100083303 12:90878213-90878235 GCAAAGAGCTGTCTCTGAAAAGG - Intergenic
1100241152 12:92711607-92711629 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1100787929 12:98098420-98098442 ACCTAAAGTTGTCTTTCAAATGG + Intergenic
1101264131 12:103066123-103066145 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1101572398 12:105965921-105965943 GCCAAGAGCTGTTTCTCAAAAGG + Intergenic
1101697457 12:107139829-107139851 GCCAAGAGCTTTTTCTCAAAAGG + Intergenic
1101739414 12:107489219-107489241 GCCAAGATTTGTTTTTTAAATGG - Intronic
1102427784 12:112857965-112857987 TCCAAGTGTTGTCTCTAAATGGG + Intronic
1103035612 12:117654064-117654086 GCCAAGAGCTGTCTCTTAAAAGG - Intronic
1103396527 12:120611448-120611470 GTCAAGAGCTGTCTCTCAAAAGG - Intergenic
1104533198 12:129592350-129592372 GGCAAGAGTAGTATTTCAAATGG - Intronic
1105740109 13:23315177-23315199 GCCAAGAGTTGTCTCTCAAAAGG - Intronic
1106925946 13:34613304-34613326 ACCAAAACTTGACTCTCAAAGGG + Intergenic
1107165470 13:37277736-37277758 GCCAATAATTGTCTCTCAAAGGG - Intergenic
1107505169 13:41026618-41026640 GTCAAGAGCTGTCTCTCAAAAGG - Intronic
1107983576 13:45755971-45755993 GCCAAGAGCTGTCTCTCAAGAGG + Intergenic
1108302434 13:49091984-49092006 GCCAAGAGCTGTCTCTCCAAAGG + Intronic
1108755911 13:53502056-53502078 GCCACGTGTTGTCACTTAAAAGG - Intergenic
1108904278 13:55449972-55449994 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1108914301 13:55588870-55588892 GCCAAGAGCTGTCTTTCAAAAGG + Intergenic
1109519022 13:63484802-63484824 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1109583048 13:64366168-64366190 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1109933292 13:69245174-69245196 GCCAAGAACTGTTTCTCAAGAGG + Intergenic
1109951024 13:69502204-69502226 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1110143763 13:72164813-72164835 GCCTAGACCTGTTTCTCAAAGGG + Intergenic
1110834135 13:80064628-80064650 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1111044400 13:82795987-82796009 GCCAAAAGCTATGTCTCAAAAGG - Intergenic
1111381980 13:87467744-87467766 GCCATGAGATCTTTCTCAAACGG - Intergenic
1111432253 13:88159633-88159655 GCCAAGATCTGTCTTTCAAAAGG + Intergenic
1111541572 13:89674210-89674232 GGAAAGAGTTGTCTTCCAAAGGG + Intergenic
1112249928 13:97770277-97770299 CCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1112628729 13:101137193-101137215 ACCATGGGTTGTATCTCAAAGGG - Intronic
1113319705 13:109221662-109221684 GTCAAGAGCTGTCTCTCCAAAGG + Intergenic
1113693818 13:112330293-112330315 GCCAAGAGGCGTCACTCACATGG - Intergenic
1114390794 14:22306164-22306186 TCCAAGAGTTCTCTCTAAGAAGG - Intergenic
1114537922 14:23434545-23434567 ACCATTAGTTGTCTCTCAGATGG - Intronic
1114758258 14:25283875-25283897 GTGAAGAGCTATCTCTCAAAAGG + Intergenic
1114905375 14:27120421-27120443 GCCAATAGCTGTCTCTCATAAGG + Intergenic
1115059716 14:29173895-29173917 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1115130693 14:30049261-30049283 GCCAAGAGCTGTCTCTTAATAGG - Intronic
1116058908 14:39896939-39896961 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1116158379 14:41236664-41236686 GCCAAGAGCTGTCTCTCAAAGGG + Intergenic
1116308044 14:43283446-43283468 GCCAAGAGCTGTCTTTCCAAAGG + Intergenic
1117001599 14:51376313-51376335 ACCAAGAGCTGTCTCTCAAAAGG - Intergenic
1117216843 14:53560176-53560198 GCCAAGAGGTGTCTCTCAAAAGG - Intergenic
1117634133 14:57724374-57724396 GCCAACAGCTGTCTCTCAAAAGG - Intronic
1117780114 14:59223383-59223405 CCCAAGAGCTGTCTCTCAGAAGG + Intronic
1118122434 14:62860169-62860191 GCTAAGAGCTGTCTCTCAAAAGG + Intronic
1118880774 14:69824017-69824039 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1119059697 14:71462189-71462211 ACAAAGAGCTGTCTCTCAAAAGG + Intronic
1119107564 14:71938838-71938860 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1119143377 14:72288243-72288265 GTCAAGAATTGTCCCTCAAAAGG + Intronic
1120082025 14:80227529-80227551 GCAAAGAGCTGTCTCTCAAAAGG + Intronic
1120710469 14:87788090-87788112 GCCAAAAGCTGTTTATCAAAAGG + Intergenic
1122426407 14:101608829-101608851 GCCAATATCTGTCTCTCAATTGG - Intergenic
1202935478 14_KI270725v1_random:83687-83709 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1123794346 15:23756524-23756546 GCCAATAATTGTCTCTCAAATGG - Intergenic
1123908498 15:24943653-24943675 GCCAACAGCTGTTTCTCAAAAGG + Intronic
1124703345 15:31936816-31936838 GTCGAGAGCTGTCTCTCAAAAGG - Intergenic
1125249224 15:37680251-37680273 GCCAATAATTATCTCTTAAATGG + Intergenic
1126189876 15:45868188-45868210 GCCAGGAGTTATCTTTCAAATGG - Intergenic
1126283610 15:46986278-46986300 GCCAAGAGTTGTTTCTTAAAAGG - Intergenic
1126375802 15:47995748-47995770 GTCAAGGGTTTTCTCTCACAGGG - Intergenic
1127356916 15:58209190-58209212 GCCAAGAGCTGTCTCTCCCAAGG - Intronic
1128642811 15:69352224-69352246 GCCAAGAGCTGCCTCCCAAAAGG - Intronic
1129649584 15:77473817-77473839 GCCAGCAGTTGTTTCTTAAAAGG + Intronic
1131409154 15:92191541-92191563 GCCAAGCATTGTCTCTAAAGAGG + Intergenic
1131724010 15:95202796-95202818 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1135061636 16:19276005-19276027 GCCAAGAGCCATCTCTCAACAGG + Intergenic
1135626003 16:23995497-23995519 GCCAAGAGCTGTCTCTTAATAGG - Intronic
1136250942 16:29004592-29004614 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1140399255 16:74657085-74657107 GTCAAGAGTAGTCTTGCAAATGG + Intronic
1141559543 16:84858037-84858059 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1141845824 16:86608287-86608309 GCCAAGAGCTGTCTGAAAAACGG - Intergenic
1141906113 16:87028106-87028128 ACCAAGAGTTGACTCTCTCAAGG + Intergenic
1142588382 17:988583-988605 TCCAAAAGCTGTGTCTCAAAAGG + Intergenic
1146237983 17:31185949-31185971 GTCAAGAGCTGTATCTCAAAAGG - Intronic
1146836355 17:36114001-36114023 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1146850933 17:36221041-36221063 GCTAAGAGCTGTCTCTCAAAAGG - Intronic
1149379495 17:56079126-56079148 GCCAAAGGTTGTTTCTCATAAGG + Intergenic
1150143457 17:62749433-62749455 TCAAAGAGTTGTCTCTCCATTGG - Intronic
1150610920 17:66732454-66732476 GTAAAGAGTTGTCTCTTAATAGG + Intronic
1153049135 18:884700-884722 GCCAAGTGCTGTTTCTCAAAAGG - Intergenic
1153089709 18:1330159-1330181 GCCAAGAGCTGTCTCTCGAAAGG - Intergenic
1153131273 18:1857712-1857734 CCTAAGAGCTGTCTCCCAAAAGG + Intergenic
1153184394 18:2470744-2470766 GCCAAGAGCCATGTCTCAAAAGG - Intergenic
1153655370 18:7277531-7277553 GACTAGAGTTGGTTCTCAAATGG - Intergenic
1153985221 18:10344955-10344977 GCCAAGAGTGCCCTCTCAAGGGG + Intergenic
1154068465 18:11131096-11131118 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1154129537 18:11724827-11724849 GCCAAGGGTTGTTTCTTAAAAGG + Intronic
1154252671 18:12757278-12757300 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1154506172 18:15042887-15042909 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1155940404 18:31796926-31796948 GCAGAGCGTTGTCTCTAAAATGG + Intergenic
1155940707 18:31799595-31799617 ACCAAGAGCTGTCTCTCAAAAGG - Intergenic
1156303860 18:35858691-35858713 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1156606371 18:38671762-38671784 GCCAAGAAATGTCTCTCAAAAGG - Intergenic
1156698785 18:39799152-39799174 TCCTAGAGCTGTCTCTTAAAGGG - Intergenic
1156998579 18:43497726-43497748 GCCAAAAGCTATCTCTCAAAAGG - Intergenic
1157341202 18:46780024-46780046 GCCAAGAGTTGTCTCTCAAAAGG - Intergenic
1159163752 18:64676665-64676687 CACAAGAGTTATCTCTCAAGAGG - Intergenic
1159277140 18:66235522-66235544 GCCAAGAGCTGTTTCTCAACAGG - Intergenic
1159456191 18:68662600-68662622 GCCAACAGCTGTTTCTCCAAAGG - Intergenic
1159559105 18:69975354-69975376 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1160092463 18:75840012-75840034 GCCAAGAGCTGTCTCTCAAGAGG - Intergenic
1163264808 19:16213792-16213814 GCCAAGAATGGTGTCTTAAAGGG + Intronic
1164097086 19:22021346-22021368 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
1164117258 19:22234577-22234599 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
1164298193 19:23934967-23934989 GCCAAGAAATGACTCTCTAATGG + Intronic
1164724225 19:30454648-30454670 GCCAAGCCTTCTCTCTCAACAGG - Intronic
1165348853 19:35266031-35266053 GCCAACATTTGTCAATCAAAAGG - Intronic
1166211325 19:41308419-41308441 GCCCAGCATTGTCTCTCACAAGG - Intronic
1167640110 19:50676775-50676797 GGGAAGTGTAGTCTCTCAAAAGG - Intronic
1168539336 19:57197373-57197395 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
925460726 2:4060443-4060465 ACAAAGAGCTGTCTCTCAAAAGG - Intergenic
925461122 2:4063575-4063597 GCCTATTGTTGTCTCTCACATGG + Intergenic
925499408 2:4486927-4486949 GTCAAGAGCTTTCTCTCAAAAGG + Intergenic
926810396 2:16750679-16750701 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
926826762 2:16913665-16913687 GCCAAGATCTGTCTCTCAAAAGG - Intergenic
927008717 2:18879721-18879743 GCCAAGAGCTGTCTGTCAAAAGG - Intergenic
927325992 2:21805927-21805949 ACCAAGAGTTAACTCTCAGAGGG + Intergenic
927660432 2:24988666-24988688 GCCAAGAGCCGTCTCTCAAAAGG - Intergenic
929269826 2:39960784-39960806 GCCAAGAGCTGTTTCTCAAAAGG + Intergenic
929550261 2:42886029-42886051 TCCAAGAGTTGTCTCTCAAAAGG - Intergenic
930248917 2:49013663-49013685 ACCAAGAGTTGTCTATCTTAAGG - Intronic
930295404 2:49547512-49547534 GCCAAGAGCTCTTTCTCAAAAGG + Intergenic
930910149 2:56620896-56620918 GTGAAGAGCTATCTCTCAAAAGG - Intergenic
931455518 2:62407060-62407082 ACCAAAAGCTGTTTCTCAAACGG + Intergenic
932641558 2:73452365-73452387 GCCCAGTGTTATCTCTCAACAGG + Exonic
932870707 2:75395084-75395106 GCCAGGAGCTGTCTCTCAAAAGG + Intergenic
933176350 2:79178116-79178138 ATCAAGAGTTGTCTCTCCAGAGG + Intergenic
933394463 2:81713358-81713380 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
934305741 2:91820593-91820615 GACAAGAGCTGTCTCTCAAAAGG - Intergenic
934327515 2:92032149-92032171 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
934333344 2:92096158-92096180 TTCAAGAGTGCTCTCTCAAAAGG - Intergenic
934465904 2:94262728-94262750 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
935183935 2:100714898-100714920 GCCAAGAGCTGTCTGTCAAAAGG - Intergenic
935425110 2:102911328-102911350 GCCAAGAGCTGTATCTCAAAAGG + Intergenic
935564309 2:104590254-104590276 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
935944630 2:108274366-108274388 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
936247500 2:110841111-110841133 GACAGGAGGTGTCTCTCAATAGG - Intronic
936646288 2:114376383-114376405 GCCATGAGCTGTCCCTCAAAGGG + Intergenic
936944766 2:117920484-117920506 GCCAGGAGATGTCTCCCATAGGG - Intronic
937582064 2:123499168-123499190 GCCAAGAACTGTCTCTCAAAAGG + Intergenic
937785206 2:125887729-125887751 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
937800327 2:126074727-126074749 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
937852570 2:126648739-126648761 GCCAAGTGCTGTCTCTCAAAAGG + Intergenic
937867151 2:126761081-126761103 GCCAAGAGCTCTTTCTCAAAAGG - Intergenic
938203931 2:129401172-129401194 GCCACGAGCTGTTTCTCAAAAGG - Intergenic
939069062 2:137517855-137517877 GCCAAGAGCTGCCTTTCAAAAGG - Intronic
939213872 2:139212239-139212261 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
939788686 2:146546114-146546136 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
939806240 2:146778473-146778495 GCCGAGAGCTGTCTTTCAAAAGG - Intergenic
939822615 2:146976373-146976395 GCCAAGAGAGGTCATTCAAAGGG + Intergenic
940171313 2:150832713-150832735 GCCAAGAGCTGTATCTCAAAAGG + Intergenic
940472090 2:154113128-154113150 GTCTAGAGCTGTCTCTCAAAAGG + Intronic
940544764 2:155069836-155069858 GCCAAGAGATGTTCCTCAAAGGG + Intergenic
940605916 2:155924289-155924311 GCCATGAGCTGTCTCTCTAAAGG + Intergenic
941454023 2:165694314-165694336 ATCAGGAGTTGTTTCTCAAAAGG + Intergenic
942221845 2:173776412-173776434 ACCCAGAGTTGTTTTTCAAAAGG + Intergenic
942321945 2:174743545-174743567 GCTAAGAGCTATCTGTCAAAAGG - Intergenic
943006897 2:182395840-182395862 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
943239219 2:185362573-185362595 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
943517598 2:188907243-188907265 GCCAAGAGATGTCTCTCAAAAGG + Intergenic
944372256 2:198998591-198998613 GCCAAGAGCTATTTTTCAAAAGG - Intergenic
944448613 2:199818264-199818286 CCCATGATTTGTCTCACAAATGG - Intronic
945544870 2:211138156-211138178 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
945642178 2:212443836-212443858 TCCAAGAGCTGTCTCTCAAAAGG - Intronic
945717835 2:213380670-213380692 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
945725845 2:213471496-213471518 ACCAACATCTGTCTCTCAAAAGG + Intronic
946527868 2:220539968-220539990 GCCAAGAGCTGTCTCTGAAGAGG + Intergenic
946703774 2:222437793-222437815 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
946790921 2:223299759-223299781 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
946873541 2:224106442-224106464 GCCAAGAGCTGTTTCTCGAAAGG + Intergenic
947440715 2:230118667-230118689 GCCTGGAGCTGTCTCTCAAAAGG + Intergenic
947440847 2:230120256-230120278 GCCCAGAGCTGTCTCTCAAAAGG - Intergenic
947515243 2:230798041-230798063 GCTGAGAGGTGTCTCTCTAATGG + Intronic
947758371 2:232585782-232585804 CCCAAAAGTTGTCTCCCAAGTGG + Intergenic
1169119441 20:3086035-3086057 GCCCAGTGTTGCCTCTCAAAGGG - Intergenic
1171330072 20:24329672-24329694 GCCAAAAGCTGTTTCTCAAAAGG + Intergenic
1173032761 20:39377725-39377747 GCCAAGACTAGTCAATCAAAGGG - Intergenic
1174121984 20:48272686-48272708 GCCAGGAATGCTCTCTCAAAGGG - Intergenic
1176596901 21:8705923-8705945 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1176791681 21:13326137-13326159 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1176998160 21:15580183-15580205 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1177139416 21:17342270-17342292 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1177192844 21:17870916-17870938 TCAAAGAGCTGTCTCTCAAAAGG + Intergenic
1177505561 21:22014183-22014205 GCCAAAAGCTGTCTCTCAAAAGG + Intergenic
1177781015 21:25622425-25622447 GCCAAAAGCTGTTTCTCAAAAGG + Intergenic
1177913175 21:27056209-27056231 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1178012660 21:28305174-28305196 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1178060755 21:28851139-28851161 GCCAAGAACTGTTTCTCAAAAGG + Intergenic
1178634466 21:34290196-34290218 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1179415150 21:41192522-41192544 GCCAAGAGCTCTCTCTCAGAAGG + Intronic
1179458194 21:41514144-41514166 GCTAAGAGCTATTTCTCAAAAGG + Intronic
1180279823 22:10683365-10683387 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1180587039 22:16901901-16901923 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1180591147 22:16938368-16938390 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1184603561 22:45558376-45558398 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1184638697 22:45857041-45857063 GCCAAGGGCTGTTTCTCGAAAGG + Intergenic
1185033674 22:48459538-48459560 GCCAAGAGCTGTTTCTCAAAAGG + Intergenic
1202727764 2_KI270716v1_random:22766-22788 TTCAAGAGTGCTCTCTCAAAAGG - Intergenic
949125665 3:443147-443169 GCAAAGAACTGTCTCTCAAAAGG + Intergenic
949170040 3:986605-986627 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
949245868 3:1924921-1924943 ACCAAGAGCTGTCTCTCAAAAGG - Intergenic
949417592 3:3830884-3830906 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
949445611 3:4131052-4131074 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
949638779 3:6012515-6012537 GCTGAGAGCTGTCTCTCAAAAGG - Intergenic
949751318 3:7355561-7355583 GCCAAAAGCTGTCTCTCTAAAGG - Intronic
949905875 3:8858056-8858078 GCCAAGAGCTGTTTCTCAGAAGG - Intronic
951003619 3:17592850-17592872 GCCAAAAGCTGTCTCTCAAAAGG - Intronic
951122571 3:18945565-18945587 GCCTAGAGCTGCCTCTCAAAAGG - Intergenic
951291519 3:20876747-20876769 GCCAAGTGCTGTCTCACAAAAGG + Intergenic
951384525 3:22027533-22027555 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
951571101 3:24064192-24064214 GCCAAGAGCCATTTCTCAAAAGG + Intergenic
951970763 3:28441867-28441889 ACCAAGAGCTGTCTCTCAAAAGG + Intronic
951978821 3:28543634-28543656 GCCAAGAGGTATTTCCCAAAAGG - Intergenic
952605445 3:35142017-35142039 GCCAAGGGCTGTCTCAGAAAAGG + Intergenic
952877916 3:37962979-37963001 GCAAAAAGTTTTCTATCAAAAGG - Intronic
954054156 3:48007958-48007980 GCCAAGAGCTGACTCTCAAAAGG - Intronic
954511491 3:51129663-51129685 GCCAAGAGCTGCCTCTCAAAAGG + Intronic
954906236 3:54065428-54065450 GACATGAGTCGTCGCTCAAAGGG - Intergenic
955035584 3:55264090-55264112 GTCAAGAACTGTCTCTCAAAGGG - Intergenic
955418754 3:58716569-58716591 GCCAAAAGTGGTCTCTCACATGG + Intergenic
955874669 3:63476570-63476592 GGTAAGAGTTGATTCTCAAATGG - Intronic
956360452 3:68441436-68441458 GCCAAGAGCTATCTCTCAAAAGG - Intronic
956509661 3:69980370-69980392 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
956703895 3:71982889-71982911 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
957298499 3:78361645-78361667 GCCAAGAGCTGTTTCTTAAAAGG + Intergenic
957615736 3:82524327-82524349 GCCCACAGTTGTCTGTCACATGG - Intergenic
957754597 3:84469424-84469446 GCCAAGAGCTGTCTCAGAGAAGG - Intergenic
958487678 3:94732476-94732498 GCCAAGAGCTGTCTCTTAAAAGG + Intergenic
958667681 3:97161237-97161259 GCCAAAAGCTGTTTCTCAAAGGG + Intronic
958934302 3:100240626-100240648 GTCCAGAGCTGTCTCTCTAAAGG - Intergenic
959203651 3:103279247-103279269 GCCAAGAGCCATTTCTCAAAAGG + Intergenic
959226779 3:103597278-103597300 GCCAAAAGCTGTCTCTTAAAAGG + Intergenic
959377344 3:105602836-105602858 GCCAAGAGCTGTCTTTCAAAAGG + Intergenic
959439509 3:106359180-106359202 GCCAAGCGTTGTCTCTCAAAAGG - Intergenic
959746014 3:109777275-109777297 TCCAAAAGCTGTCTCTCAAAAGG + Intergenic
959967432 3:112372950-112372972 GCCAAAAGCTGTTTCTCAAAAGG + Intergenic
960349529 3:116575699-116575721 ACCAAGAGCTGTCTCTCAAAAGG - Intronic
960494746 3:118360782-118360804 GCCAAGAGCAGTCTCTCAAAAGG + Intergenic
961710979 3:128828004-128828026 GCCAAGAGCTGTCTCTCGAAAGG + Intergenic
961858849 3:129897891-129897913 GCCAAACGTTGTTTCTCAAGAGG + Intergenic
962995980 3:140628957-140628979 GCCAAAAATTCTCTCTCAACAGG - Intergenic
963268113 3:143259248-143259270 GCCATGAGTTGCTTCTCAAAAGG + Intergenic
963319190 3:143794595-143794617 GCCAAGAGTTTTCTTTCTAAAGG - Intronic
963331817 3:143923375-143923397 GCCAAGATCTGTCTCTCAAAAGG + Intergenic
963630309 3:147723218-147723240 ACCAGAAGATGTCTCTCAAAAGG - Intergenic
963661392 3:148132143-148132165 GTCAAGAGGTGTCTCTCAAAAGG - Intergenic
964505866 3:157398324-157398346 GGCCAAAGCTGTCTCTCAAAAGG + Intronic
964548475 3:157860712-157860734 TCCAAGGATTGACTCTCAAAAGG - Intergenic
964679245 3:159318916-159318938 GCCATGAGCTGTCTCTCAAAAGG + Intronic
965226767 3:166000766-166000788 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
965708644 3:171534781-171534803 GCCAAGAGCTGCTTCTCAAAAGG + Intergenic
966044330 3:175530923-175530945 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
966445693 3:179998557-179998579 ACCAAGAGCTGTCTCTCAAAAGG - Intronic
966896733 3:184450562-184450584 GCCAGGAGCCGTTTCTCAAAAGG + Intronic
967831776 3:193925988-193926010 GCCAAGAGCTGTCTCTTGAAAGG - Intergenic
968800183 4:2738119-2738141 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
968906946 4:3457965-3457987 GCCAAGAGCTGTCTTTCAAAAGG - Intergenic
969115704 4:4869503-4869525 GCAAGGAGTGGTCTCGCAAAGGG - Intergenic
970002094 4:11374432-11374454 GCAGAGAGCTGTCTCTCAAAAGG - Intergenic
970816403 4:20161302-20161324 GCCAAAAGCTGTCTCTCTAAAGG - Intergenic
971460484 4:26890521-26890543 GCCAAAATCTGTTTCTCAAAAGG + Intronic
971817228 4:31505073-31505095 GCTAAGAGTTGTCTCTCAAAAGG - Intergenic
971897540 4:32617003-32617025 GCCAAGAGCTGTCACTCAAAAGG - Intergenic
971979295 4:33732875-33732897 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
972095493 4:35342687-35342709 GCCAAGAGCATTCTCTCAAAAGG - Intergenic
972805916 4:42529325-42529347 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
972882961 4:43448156-43448178 GCAAACAGCTGTCTCCCAAAAGG + Intergenic
973098052 4:46226758-46226780 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
973118442 4:46489041-46489063 GCCAAGAGCTGCCTCTCAAAAGG - Intergenic
973130190 4:46639697-46639719 GCCAAGGGCTATCTCTCAAAAGG + Intergenic
973143681 4:46798604-46798626 GCCAAGAGCTATTTTTCAAAAGG - Intronic
974262371 4:59542271-59542293 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
974479038 4:62420838-62420860 GTCAAGAGCTGCCTCTCTAAAGG + Intergenic
974557605 4:63471897-63471919 ACCAAGAGCTAACTCTCAAAAGG - Intergenic
974814736 4:66989610-66989632 GCCCAGATTTGTCCCTGAAAAGG + Intergenic
975024468 4:69531630-69531652 GCCATGAGCTGTCTCTCAAAAGG - Intergenic
975051323 4:69868199-69868221 TCCAAGATCTGTCTCTCAAAAGG - Intergenic
975620751 4:76293976-76293998 GCCAAAATCTGTTTCTCAAAAGG + Intronic
975740166 4:77422049-77422071 GCAAAGAGTTGTCGATCACAGGG - Intronic
975982615 4:80177279-80177301 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
977031621 4:91891405-91891427 AAAAAGAGCTGTCTCTCAAAGGG - Intergenic
977163277 4:93663362-93663384 GCCAAAATGTGACTCTCAAATGG - Intronic
977204716 4:94155682-94155704 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
977384913 4:96326534-96326556 GCCAAAAGCTGTTTCTCAAAAGG - Intergenic
977466001 4:97383372-97383394 ACCAAGAGTTGTCTCTCAAAAGG - Intronic
977490071 4:97700073-97700095 GCCAAGAGCTGTCCCTCAAAAGG + Intronic
977626276 4:99192656-99192678 GCCAAGAGCTATCTCTCAAAAGG + Intergenic
977701731 4:100029889-100029911 GCCAAGAGCTGTCACTCAAAAGG + Intergenic
977833275 4:101618170-101618192 GCCAAGAGCTGTCTTTCAAAAGG + Intronic
977930412 4:102743821-102743843 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
977976563 4:103273329-103273351 GCCAGGAGCCGTTTCTCAAAAGG + Intergenic
978341590 4:107725551-107725573 GCCACAAGCTGTCTCTCAAAAGG + Intergenic
978513365 4:109545955-109545977 GCAAAAAGTGGTCTTTCAAAAGG + Intergenic
978661920 4:111137339-111137361 TCCAAGAGTTGGCTCTTGAATGG - Intergenic
978772152 4:112467782-112467804 GCCAAAAGCTGTCTCTCAAAAGG + Intergenic
978899075 4:113926820-113926842 GCCAAGAGCTGTCCCTCAAAAGG + Intronic
979344459 4:119570561-119570583 GCCAAGACTTGACTCTCACTGGG + Intronic
979767020 4:124474593-124474615 GCCAAGAGCTGTCTCTTAAAAGG - Intergenic
979898402 4:126189059-126189081 GCCAAGAGCTTTCTCTCAAAAGG + Intergenic
980387947 4:132111183-132111205 GCCAAGTGTTGTCTCTCAAAAGG + Intergenic
980405891 4:132353793-132353815 GCCAAAAGCTGTCTCTCAAAAGG + Intergenic
980602160 4:135039518-135039540 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
980957731 4:139445915-139445937 GCCAAAAGCTGTCTCTCAGAAGG - Intergenic
981462810 4:145031803-145031825 GTCAAGAGATGTCTCTCAAAAGG - Intronic
981835003 4:149043943-149043965 GCCAAGAGCTGTCTCTCAACAGG - Intergenic
981979355 4:150772606-150772628 GCCAAGAGTTGTTTCTCAAAAGG + Intronic
982597775 4:157407028-157407050 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
982623341 4:157732903-157732925 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
982835539 4:160116639-160116661 GCCAAGAGCTCTCTCTCAAAAGG - Intergenic
982847769 4:160274294-160274316 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
983027390 4:162755293-162755315 GCCAAGAGCTGTCTCTAAAAAGG - Intergenic
983185064 4:164691573-164691595 GCCAAGAGCTGTCTCTCGAAAGG - Intergenic
983515626 4:168653511-168653533 GCCAAGAACTGTCTGTCATAAGG - Intronic
983742354 4:171151254-171151276 GCCAAAAGCTGTTTCTTAAAAGG + Intergenic
984060284 4:174982026-174982048 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
985191964 4:187384080-187384102 GCCAAAAGTTGGCTTTGAAAAGG + Intergenic
986037033 5:3950439-3950461 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
986087109 5:4462716-4462738 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
986095463 5:4549736-4549758 GCCATGACTGGTCTCTAAAAGGG - Intergenic
986312389 5:6562147-6562169 GACAAGATTTGTTTTTCAAAAGG - Intergenic
986742919 5:10719504-10719526 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
986959838 5:13199217-13199239 GCAAAGAGCTGACTCTCAAAAGG - Intergenic
987137380 5:14912660-14912682 GCCGAGAGTTGTGTCTCTCAAGG - Intergenic
987153176 5:15061664-15061686 GCCAAGAGCTGTTTCTCAAAAGG - Intergenic
987468189 5:18296986-18297008 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
987504387 5:18749852-18749874 GCCAAGAGTTGTCTCTCAAAAGG - Intergenic
987578341 5:19758313-19758335 GCCAAGAGCTGCCTCTCAAAAGG + Intronic
987646374 5:20677331-20677353 GCCAAGTTCTGTCTCTCACAAGG + Intergenic
987885444 5:23806498-23806520 GCCAACAGCCATCTCTCAAAAGG - Intergenic
988056568 5:26105269-26105291 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
988079831 5:26401421-26401443 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
988107758 5:26772545-26772567 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
988160825 5:27516872-27516894 GCCTAGATCTGTCTCTCAAAAGG + Intergenic
988169202 5:27632839-27632861 GCCAAAAGCTGACTTTCAAAAGG + Intergenic
988188775 5:27901235-27901257 GCCAAGAGCTGTCTCTTAAAAGG - Intergenic
988562130 5:32290846-32290868 GCCAAGAGCTGTCTTTCAAAAGG - Intronic
989045206 5:37267592-37267614 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
989097831 5:37797319-37797341 TCCAAAAGCTGTCTCTCAAAAGG - Intergenic
989340114 5:40364581-40364603 GCTAAGAATTGTTTCTCAAAAGG - Intergenic
989486384 5:41996360-41996382 GCCAAGAGCTGTCACTCAAAAGG + Intergenic
989862499 5:46396775-46396797 TCCAAGACTTCTCTATCAAAAGG - Intergenic
989864682 5:46435662-46435684 TTCAAAAGTTCTCTCTCAAAAGG + Intergenic
989865388 5:46497916-46497938 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989865546 5:46500650-46500672 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989865881 5:46506288-46506310 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989866500 5:46517221-46517243 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989866653 5:46519955-46519977 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989866808 5:46522688-46522710 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989866968 5:46525424-46525446 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989867157 5:46528377-46528399 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989867396 5:46532474-46532496 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989867710 5:46537936-46537958 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989868477 5:46551704-46551726 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989868817 5:46557522-46557544 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989868968 5:46560256-46560278 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989869128 5:46562988-46563010 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989869319 5:46566212-46566234 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
989874669 5:46665418-46665440 TTCAAAAGTTCTCTCTCAAAAGG - Intergenic
990761101 5:59130377-59130399 GCCGTGGCTTGTCTCTCAAATGG - Intronic
990891758 5:60658490-60658512 AGCTAGTGTTGTCTCTCAAAGGG - Intronic
991013807 5:61910901-61910923 TCCAAGGGCTGTCTCTCAAAAGG + Intergenic
991234167 5:64375162-64375184 GCCAAAAGCTGTTTCTCAAAAGG - Intergenic
991330738 5:65489685-65489707 GCCAAGAACTGTCTCTCAAAAGG + Intergenic
992242955 5:74789866-74789888 GCCAAGAACTGTTTCTCAAAAGG - Intronic
993231901 5:85247534-85247556 GCCAAGAGCTGTCTCTTAAAAGG + Intergenic
993780693 5:92062393-92062415 GTCAAGAGCTGTCTCACAAAAGG - Intergenic
993791791 5:92218910-92218932 GCCAAGAACTGTCTTTCAAAAGG - Intergenic
994291374 5:98031972-98031994 GCCAAGAGCTGTCTCTCAAAGGG + Intergenic
994539522 5:101076927-101076949 GCCAAGAGTTGCTCCTCAAAAGG - Intergenic
994855435 5:105113585-105113607 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
994984420 5:106915730-106915752 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
995063954 5:107839813-107839835 GCCAGGAGTTCTATTTCAAAAGG + Intergenic
995269557 5:110205467-110205489 GCCAAGAGCTATATCTCAAAAGG + Intergenic
995427733 5:112043727-112043749 GCCAAGAGCTTTGTCTCAAAAGG + Intergenic
996018560 5:118567855-118567877 ACCAAGAGCTGTCTCTCTAGAGG - Intergenic
996164956 5:120212509-120212531 GCCAAAAGCTGTCTCGCAAAAGG + Intergenic
996392202 5:122973786-122973808 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
996627762 5:125590007-125590029 ACTAAGAGCTGTTTCTCAAAAGG + Intergenic
996760961 5:126985126-126985148 GCCAAGAGTAGTCCCCCCAAAGG - Intronic
996825563 5:127677834-127677856 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
998290336 5:140908552-140908574 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
998631319 5:143901707-143901729 GCCCAGATTTGTCTGTCAAAAGG + Intergenic
998855888 5:146394857-146394879 GCCAGGAGTTGGCACTCAGAGGG + Intergenic
998970980 5:147592404-147592426 GCCCAGAGATGTCCCTGAAAAGG + Intronic
999351385 5:150874844-150874866 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1000223245 5:159234249-159234271 GCCAAGAGCTGTGTCTCAAAAGG + Intergenic
1001173595 5:169444642-169444664 GCCAAGAGCTGTCTTTCAAAAGG - Intergenic
1002593371 5:180306281-180306303 GCCTAGCATTGTCTTTCAAATGG + Intronic
1002997965 6:2304746-2304768 GGCAAGAGCTGTCTCTCAAAAGG - Intergenic
1003023140 6:2529486-2529508 GCCAAGAGCTGTCTCTCACGAGG - Intergenic
1003695898 6:8406140-8406162 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1003758607 6:9150081-9150103 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1003791220 6:9549991-9550013 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1004298588 6:14436672-14436694 GCCAAAAGCTGTTTCTCAAAAGG - Intergenic
1004821539 6:19373190-19373212 GCCAGGAGCTGTTTCTCAAAAGG - Intergenic
1005185168 6:23157072-23157094 CCCAACAGCTGTCTCTCAAAAGG - Intergenic
1005508113 6:26487905-26487927 TCCAATAATTCTCTCTCAAACGG - Intergenic
1006001556 6:30969075-30969097 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1006062351 6:31433222-31433244 GCTAAGAGCTGTCTCTCAAAAGG - Intergenic
1007423243 6:41732212-41732234 CCCAGGAGTTCTCTCTTAAAAGG - Intronic
1008266922 6:49439289-49439311 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1008400292 6:51055471-51055493 GCCAAGAACTGTTTCTCAAAAGG - Intergenic
1008820398 6:55625152-55625174 GCCAGGAGCTATCTCTCAAAAGG - Intergenic
1008830052 6:55747843-55747865 GCCATGAGTTGTATTTTAAAAGG - Intergenic
1009563204 6:65275241-65275263 ACCAACAGCTGTTTCTCAAAAGG - Intronic
1009660695 6:66606922-66606944 GCCAAGAGCTGTTTCTCAAAAGG + Intergenic
1009770334 6:68136852-68136874 GCCAAGAGCTATCTCTCTAAAGG + Intergenic
1009851925 6:69208958-69208980 GCCAAGAGTTGTCTCTCAAAAGG + Intronic
1010323577 6:74540489-74540511 GCCAAGAGGTGTCTCTCAAAAGG - Intergenic
1010325330 6:74556599-74556621 GCCAAGAGATGTCTTTCAAAAGG + Intergenic
1010580753 6:77593905-77593927 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1010732906 6:79409861-79409883 GCTAAGAGTTGTCTCCTATAAGG - Intergenic
1010818632 6:80388400-80388422 GCCAGGAGCTGTCTCTCAAAAGG - Intergenic
1010854103 6:80815417-80815439 GCCAAGAGATGTCTCTAAAAAGG + Intergenic
1011039344 6:83013274-83013296 GCTAAGACCTGTTTCTCAAAAGG + Intronic
1011069101 6:83361665-83361687 GCCAGGAGCTGTCTCTCAAAAGG - Intronic
1012033372 6:94101089-94101111 GACAAGAGCTGTTTCTCAAAAGG - Intergenic
1012344588 6:98170319-98170341 GCCAACAGCTATCTCTCAAAAGG - Intergenic
1012730461 6:102874319-102874341 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1012820803 6:104082918-104082940 GCCAAGAACTGTTTCTGAAAGGG - Intergenic
1013406671 6:109849802-109849824 GCCAAGAACTGTCTCTCAAAAGG - Intergenic
1014363397 6:120508354-120508376 GCCAAGAGCTCTCTCTCAAAAGG + Intergenic
1014534197 6:122596622-122596644 GCCAAGAGCTCTCTCTCAAAAGG + Intronic
1014631640 6:123796801-123796823 GTCAAGAGATGTCTCTCAAAAGG - Intergenic
1015051280 6:128843260-128843282 GCCAAGACTTTACTGTCAAAGGG - Intergenic
1015095450 6:129409601-129409623 GCCAAGAGTTGTCTCTCAAATGG + Intronic
1015378916 6:132544525-132544547 ACCAAGAGCTATCTTTCAAAAGG + Intergenic
1015443285 6:133272565-133272587 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1015466849 6:133557717-133557739 ACGAAGAGCTGTCTTTCAAAAGG + Intergenic
1015475749 6:133657491-133657513 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1015716640 6:136199526-136199548 GCCAAGAGTAGTTTTTAAAAGGG - Intergenic
1015862093 6:137691841-137691863 GCCAAAAGCTGTCTCTTAAAAGG - Intergenic
1016119915 6:140332692-140332714 GCCAAGAACTGTCTCTCAAAAGG + Intergenic
1016144290 6:140649402-140649424 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1016147330 6:140692716-140692738 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1016174915 6:141069095-141069117 GCCAAGAACTGTCTTTCAAAAGG + Intergenic
1016576258 6:145572587-145572609 ACCAAGAGCTGTCTCTCAAAAGG + Intronic
1017227805 6:152041092-152041114 GCCAAGAGTTGTCTCTCACAAGG + Intronic
1017388456 6:153912207-153912229 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1017977116 6:159368057-159368079 ACCAAGAACTGTCTCCCAAAAGG + Intergenic
1018012456 6:159683970-159683992 GCCATGAGTTGTCTGGCAGAGGG - Intronic
1018122928 6:160655223-160655245 ACCAATAGCTGTCTCTCAAAAGG + Intronic
1018534388 6:164804999-164805021 GCCAAGAGAAATGTCTCAAAAGG - Intergenic
1018535031 6:164810494-164810516 GCCAAGAGTGGTCTCTCTAAAGG + Intergenic
1018599886 6:165527526-165527548 GCCAATAGCTGTCTCTCAAAAGG - Intronic
1018803792 6:167242991-167243013 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1019110980 6:169713699-169713721 CCCAAGATTTGACTTTCAAATGG + Intronic
1020396717 7:7725514-7725536 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1020710349 7:11597625-11597647 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1021305092 7:19022527-19022549 TCCAAGAGCTATTTCTCAAAAGG + Intronic
1021372063 7:19861434-19861456 GCCATGAGCTGATTCTCAAAAGG + Intergenic
1021988809 7:26122922-26122944 GCCAAGAGCTGTCACTCAAAAGG - Intergenic
1024040537 7:45550144-45550166 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1024486833 7:49928860-49928882 TCCAAAAGCTGTTTCTCAAAAGG + Intronic
1024866103 7:53906343-53906365 GCCAAGAACTGTCTCTCAAAAGG - Intergenic
1026046490 7:66909099-66909121 GTGAAGAGCTGTCTCTCAAAAGG + Intergenic
1027685797 7:81277954-81277976 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1028036021 7:85983446-85983468 GCCAAGAGTTGTTTGGCAGAGGG - Intergenic
1028141735 7:87281983-87282005 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1028237820 7:88382820-88382842 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1028325680 7:89521848-89521870 GCAAAGATTTGCTTCTCAAAGGG + Intergenic
1028880374 7:95873189-95873211 ACCAAGACATCTCTCTCAAAGGG + Intronic
1028935013 7:96455062-96455084 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1030277458 7:107736113-107736135 GCCAAGATATGTCTCTCAAAAGG - Intergenic
1030368753 7:108674026-108674048 GCCAAGATCTGTCTCTCAAAAGG - Intergenic
1030816961 7:114050361-114050383 GCTAGTAATTGTCTCTCAAATGG - Intronic
1030931288 7:115525684-115525706 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1031236826 7:119188014-119188036 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1031538458 7:122963482-122963504 GCCAAGATTTGTCATTTAAAGGG + Intergenic
1031767824 7:125803697-125803719 GCCAAAAGCTGCCTTTCAAAAGG - Intergenic
1031832995 7:126650015-126650037 GACAAGAGCTATCTCTCAAAAGG - Intronic
1032923471 7:136576117-136576139 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1033076257 7:138253044-138253066 GCCAAGAGCTGCCTCTCAAAAGG - Intergenic
1033870218 7:145745067-145745089 GTCAACACCTGTCTCTCAAAAGG - Intergenic
1034357255 7:150460941-150460963 GCCAAAAGCTGTTTCTCAAAAGG + Intronic
1036525826 8:9533736-9533758 CCCAAGATTTGTTTCTCAGAGGG + Intergenic
1037256766 8:16964308-16964330 GCCATGAGTTGCATTTCAAAAGG - Intergenic
1037364593 8:18108271-18108293 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1037953617 8:23036100-23036122 GCCAAGAGCTGTTTCTCAAAAGG - Intronic
1039324171 8:36466527-36466549 GCCAAGGGCTATCTCTCCAAAGG + Intergenic
1039626543 8:39060154-39060176 GCCAATAGTTTTTTCTCAAAAGG + Intronic
1040487173 8:47884420-47884442 GACAAGAGTTGTAAATCAAAAGG - Intronic
1041349571 8:56935026-56935048 TCAAAGATTTGTCTTTCAAAGGG + Intergenic
1041564404 8:59260822-59260844 GCCATGAGCTGACTCTCGAATGG + Intergenic
1041934553 8:63321328-63321350 GCCGAGAGCTGTCTCTCAAAAGG - Intergenic
1042001062 8:64123998-64124020 GCCAAGAGCTGTCTCCCAAAAGG + Intergenic
1042060520 8:64811950-64811972 GCCAAAAGTTGCTTCTCAAGAGG + Intergenic
1042342420 8:67694349-67694371 GCCAAGAGCTGTCTCTCAGAAGG - Intronic
1042431960 8:68717278-68717300 GACAGGAGTTGTCTCCCACACGG + Intronic
1043553504 8:81402654-81402676 GACAAGTCTTTTCTCTCAAAGGG - Intergenic
1044133756 8:88559032-88559054 TCCAAGAGCTGTTTCTCAAAAGG - Intergenic
1044202389 8:89452486-89452508 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1044633155 8:94298408-94298430 GCCAAGAGCTGCCTCTCAAAAGG + Intergenic
1046128674 8:109941604-109941626 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1046254600 8:111679954-111679976 GAAAAGATTTGTGTCTCAAAGGG + Intergenic
1046384813 8:113495455-113495477 ACCAAGAGCTGTTTATCAAAAGG - Intergenic
1046417638 8:113937796-113937818 GCCAAGACCTGTCTCTCAAAAGG + Intergenic
1047453630 8:124989311-124989333 GCCAAGAGCTATCTTTCAAAAGG - Intergenic
1048745116 8:137605889-137605911 TCCAAGAGTTGTCACTAGAAAGG + Intergenic
1049121611 8:140744226-140744248 GCCAACAGATGTCACTCATAAGG + Intronic
1050482674 9:6102601-6102623 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1051008004 9:12372267-12372289 GCAAAGATTTATATCTCAAAGGG + Intergenic
1051966462 9:22834575-22834597 GCAAAGGGCAGTCTCTCAAAAGG - Intergenic
1052227589 9:26108374-26108396 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1052368650 9:27640834-27640856 GCCAAGGGCTGTCTCTCAAAAGG - Intergenic
1052442270 9:28512284-28512306 GCCAGGAGCTGACTCTCAAAAGG + Intronic
1053610819 9:39711427-39711449 GCCAAGAGTTGTTTCTCAAAAGG - Intergenic
1053695958 9:40639505-40639527 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1053868855 9:42469449-42469471 GCCAAGAGTTGTTTCTCAAAAGG - Intergenic
1053942943 9:43270543-43270565 GACAAGAGCTGTCTCACAAAAGG + Intergenic
1054087435 9:60759731-60759753 GCCAAGAGTTGTTTCTCAAAAGG + Intergenic
1054242703 9:62630968-62630990 GCCAAGAGTTGTTTCTCAAAAGG + Intergenic
1054307205 9:63438723-63438745 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1054405938 9:64762715-64762737 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1054439564 9:65248202-65248224 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1054490843 9:65773737-65773759 GACAAGAGCTGTCTCTCAAAAGG - Intergenic
1054556827 9:66665486-66665508 GCCAAGAGTTGTTTCTCAAAAGG + Intergenic
1055903941 9:81271206-81271228 GCCAAGAGGTATCTCTCAAAAGG + Intergenic
1056156666 9:83845207-83845229 GCCAAGAGCTGTCTCTTAAAAGG - Intronic
1056353872 9:85778320-85778342 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1056718502 9:89053662-89053684 GCCAAGAGATGTGTCTACAAAGG + Intronic
1057058996 9:91986588-91986610 GCCAAGAGCTGTTTTTCAAAAGG - Intergenic
1058019896 9:100076078-100076100 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1058239797 9:102542491-102542513 GCTAAGAGCTGTCTCTCAAAAGG - Intergenic
1058259799 9:102814553-102814575 GCCAAGTGTTCTCTCTCAACAGG + Intergenic
1058544166 9:106042752-106042774 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1059196506 9:112375870-112375892 GCTAAGAGCTGTCTCTCAAAAGG + Intergenic
1060178780 9:121517315-121517337 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1202778405 9_KI270717v1_random:13118-13140 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1203409193 Un_KI270538v1:84162-84184 TTCAAAAGTTCTCTCTCAAAAGG + Intergenic
1203409252 Un_KI270538v1:86691-86713 TTCAAAAGTTCTCTCTCAAAAGG + Intergenic
1203409404 Un_KI270538v1:89425-89447 TTCAAAAGTTCTCTCTCAAAAGG + Intergenic
1186279495 X:7977116-7977138 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1186384094 X:9091764-9091786 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1186469767 X:9812111-9812133 GCCAAGAGCTTTATCTCAAAAGG + Intronic
1187604865 X:20871860-20871882 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1187718668 X:22129654-22129676 GCCATGAGTGGTGTCTCAGAGGG - Intronic
1187850839 X:23590208-23590230 GCCAACAATAATCTCTCAAATGG + Intergenic
1187939948 X:24371780-24371802 GCCAAGAGTTGTATGTAGAAGGG - Intergenic
1189154884 X:38746724-38746746 GCCAAGAACTGTCTCTCAAAAGG + Intergenic
1189224428 X:39400904-39400926 GCCTAAAGTAGTCTCCCAAAAGG + Intergenic
1190255273 X:48757801-48757823 GCCAAGAGCTGTTTCTCAAAAGG - Intergenic
1190527879 X:51346251-51346273 GCCAAGAGCTATTTCTCAAAAGG + Intergenic
1190601538 X:52097837-52097859 ACCAAGAGCTGTTTCTCAAAAGG + Intergenic
1190705819 X:53027287-53027309 GCTAGTAGTTGTTTCTCAAAAGG - Intergenic
1191134034 X:57044490-57044512 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1191630038 X:63312591-63312613 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1191658805 X:63629809-63629831 GCCAAGAGCTGTCTTTAAAAAGG + Intergenic
1191719242 X:64215712-64215734 GCGAGGAGCTGTCTTTCAAAAGG + Intergenic
1191742540 X:64451311-64451333 GCCAATAGCTGTTTCTCAAAAGG + Intergenic
1191769495 X:64740101-64740123 GCCAAAAGCTGTCCCTCAAAAGG + Intergenic
1191946353 X:66539008-66539030 ACCAAGAGCAGTCTCTCAAAAGG - Intergenic
1191946914 X:66544501-66544523 TCCAGGAGTTGGCTCTTAAATGG - Intergenic
1192297711 X:69868019-69868041 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1192657637 X:73008975-73008997 GCCAGGAATTGTCTCTCAAAAGG + Intergenic
1192661563 X:73047765-73047787 GCCAAGAGCTATTTCTCAAAAGG + Intergenic
1192787511 X:74349594-74349616 GCCAGGAGTTGCCTCTCTAGTGG - Intergenic
1192824486 X:74681191-74681213 GCCAAAAGCTGTTTCTCAAAAGG - Intergenic
1192898703 X:75471906-75471928 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1192996192 X:76515574-76515596 GCCAAGAGCTGTTTCTGAAAAGG - Intergenic
1193053490 X:77125764-77125786 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1193297780 X:79852670-79852692 GCCAAGAACTGTTTCTCAAAAGG - Intergenic
1193573668 X:83174935-83174957 GCCAAGAGCTGTCTCTAAAAAGG + Intergenic
1193832947 X:86310093-86310115 GTCAAGAGCTGTCTCTTAAAAGG - Intronic
1193904485 X:87225827-87225849 TCAAAGAGCTGTCTCTCAAAAGG - Intergenic
1193914802 X:87351932-87351954 GCCAAGAGCTGTTTCTCAAATGG + Intergenic
1193957284 X:87878206-87878228 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1194072286 X:89340616-89340638 GCCAAGGGCTGTATCTCAGAGGG + Intergenic
1194155336 X:90380935-90380957 GCCAAGAACTGTTTCTCAAAAGG + Intergenic
1194179591 X:90695939-90695961 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
1194210278 X:91062350-91062372 GCCAAGAGCAGTCTCTCAAAAGG - Intergenic
1194343310 X:92731080-92731102 GCCAACGGCTGTCTCTCAAAAGG - Intergenic
1194443549 X:93961099-93961121 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1194482724 X:94446562-94446584 GCCAAATGCTGTCTCTGAAAAGG - Intergenic
1194513418 X:94822256-94822278 GCCAAGAGCTGTCTCTCAAATGG + Intergenic
1194521081 X:94919435-94919457 GTCAAGAGATGTCTCTCCAAAGG - Intergenic
1194626615 X:96233162-96233184 GCCAAGAACTGTCTTGCAAAAGG - Intergenic
1194833958 X:98658800-98658822 GCCAAGAGCTCGCTCTCAAAAGG - Intergenic
1194849246 X:98852178-98852200 ACCAAGAGCTGTCTCTCAAAAGG + Intergenic
1194870721 X:99127862-99127884 TCTAAGAGTGGTCTCTCAATAGG - Intergenic
1195782353 X:108479869-108479891 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1195982619 X:110595835-110595857 GCCAAGAGGTGTTTCTTAAAAGG - Intergenic
1196114481 X:111984129-111984151 GCTAAGAGCTGTTTCTCAAAAGG + Intronic
1196135969 X:112209847-112209869 TCCAAGAGCTGTCTTGCAAAAGG + Intergenic
1197002289 X:121452920-121452942 ACCATGAGCTATCTCTCAAAAGG - Intergenic
1197038378 X:121905041-121905063 TCCTAGACTTGTCTCTTAAAGGG + Intergenic
1197084197 X:122453503-122453525 GCCAAGAGCTGTCTCTCAAAGGG + Intergenic
1197097468 X:122612834-122612856 GCCAAAACCTGTCTCTCAAAAGG - Intergenic
1197245046 X:124158998-124159020 GCCAAGAGCTGTCTCTCAAAAGG + Intronic
1197313340 X:124932972-124932994 CCCAAGAGTTGCCTCTGAAAGGG + Intronic
1197372056 X:125637870-125637892 GCCAAGAGCTGCCTCTCAGAAGG + Intergenic
1197386773 X:125812247-125812269 GCCAAGAGCCGGTTCTCAAAAGG + Intergenic
1197405087 X:126039194-126039216 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1197409324 X:126096419-126096441 GCAATGAGCTGTCTCTCAAAAGG + Intergenic
1197477359 X:126941333-126941355 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1198701300 X:139400292-139400314 GCCAAGAGCCGTCTCTCAAAAGG - Intergenic
1198783040 X:140257801-140257823 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1198934040 X:141887875-141887897 GCCAAGAGCTGTCTCTCAAAAGG - Intronic
1199008507 X:142730883-142730905 GCAAAAAGATGTTTCTCAAAAGG - Intergenic
1199024379 X:142919715-142919737 TCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1199040591 X:143111096-143111118 ACCAAGAGCTGTCTCTCAAAAGG - Intergenic
1199144442 X:144348969-144348991 GCCAAGAGCTGTTTCTCAAAAGG + Intergenic
1199310427 X:146314404-146314426 GCCAAGAGCTGTCTCTCAAAAGG + Intergenic
1199997704 X:153036665-153036687 GTCAAGCGTTGTCTCTGCAAGGG - Intergenic
1200289356 X:154857135-154857157 GCCAAGAGCTATCTCACAAAAGG - Intronic
1200501685 Y:3957868-3957890 GCCAAGAACTGTTTCTCAAAAGG + Intergenic
1200521270 Y:4212026-4212048 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1200526253 Y:4278108-4278130 GCCAAGAGTTGTCTCTCAAAAGG + Intergenic
1200651669 Y:5847745-5847767 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1200726528 Y:6676367-6676389 GCCAAGGGCTGTATCTCAGAGGG + Intergenic
1200727680 Y:6692143-6692165 GCCAAGGGCTGTATCTCAGAGGG + Intergenic
1200746058 Y:6904876-6904898 GCCAAGAGCTATCGCTCAAAAGG + Intergenic
1200976629 Y:9218476-9218498 GCCAAGAGCTGTCTCTCAAAAGG - Intergenic
1201193719 Y:11471421-11471443 GACAAGAGCTGTCTCTCAAAAGG + Intergenic
1201529652 Y:14977898-14977920 GCCAAAAGCCTTCTCTCAAAAGG + Intergenic
1201798427 Y:17926695-17926717 GCCAAGAGCTGTCTCTCAATAGG - Intergenic
1201803126 Y:17979262-17979284 GCCAAGAGCTGTCTCTCAATAGG + Intergenic
1202359747 Y:24095385-24095407 GCCAAGAGTTGTCTCTCAATAGG - Intergenic
1202511031 Y:25574729-25574751 GCCAAGAGTTGTCTCTCAATAGG + Intergenic